Below is a DNA strand. We will call this the original strand, and you will transcribe and translate it first. Each question thereafter is a variation of the original strand with a mutation. Transcribe and translate the DNA strand for each number, and identify the type of mutation. It is important to determine where the change in DNA occurred in each mutated strand to help you identify the mutation type. Original: DNA TAC CCA GAG ATG CAT mRNA Amino Acid Mutation Type: ______________________________ Mutation 2 DNA TAC CCA GAT ATG CAT mRNA Amino Acid Mutation Type: ______________________________ Mutation 3 DNA TAC CCA GAG ATT CAT mRNA Amino Acid Mutation Type: ______________________________ Mutation 4 DNA TAC CAG AGA TGC AT… mRNA Amino Acid Mutation Type: ______________________________

Below is a DNA strand. We will call this the original strand, and you will transcribe and translate it first. Each question thereafter is a variation of the original strand with a mutation. Transcribe and translate the DNA strand for each number, and identify the type of mutation. It is important to determine where the change in DNA occurred in each mutated strand to help you identify the mutation type. Original: DNA TAC CCA GAG ATG CAT mRNA Amino Acid Mutation Type: Mutation 2 DNA TAC CCA GAT ATG CAT mRNA Amino Acid Mutation Type: Mutation 3 DNA TAC CCA GAG ATT CAT mRNA Amino Acid Mutation Type: Mutation 4 DNA TAC CAG AGA TGC AT… mRNA Amino Acid Mutation Type:

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 6QP: Which of the following best describes the process of DNA sequencing? a. DNA is separated on a gel,...

See similar textbooks

Similar questions

Below is a DNA strand. We will call this the original strand, and you will transcribe and translate it first. Each question thereafter is a variation of the original strand with a mutation. Transcribe and translate the DNA strand for each number, and identify the type of mutation. It is important to determine where the change in DNA occurred in each mutated strand to help you identify the mutation type. Original: DNA TAC CCA GAG ATG CAT mRNA Amino Acid Mutation 1 DNA TAC CAA GAG ATG CAT mRNA Amino Acid Mutation Type: ______________________________ Mutation 2 DNA TAC CCA GAT ATG CAT mRNA Amino Acid Mutation Type: ______________________________ Mutation 3 DNA TAC CCA GAG ATT CAT mRNA Amino Acid…
Shown below is a DNA coding strand. A base (*G*) mutates to Adenine (A). What will be the resulting amino acid sequence as a result of the mutation? What type of mutation occured? Hint: Determine the template, then first determine the amino acid sequence before the mutation, and then determine the amino acid sequence after the mutation. Show how you got your answer. 5' T-A-C-T-T-C-C-A-*G*-C-C-G-C-T-C 3'
What type of mutation is represented in the second strand of DNA? TACGGCACT TACGGCCACT answer choices A. Deletion B. Substitution C. No mutation D. Insertion
Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA template strand.DNA Strand: TCT AAC TAT CCC CTA Third codon change from TAT to TAG. Second codon change from AAC to ATC. Nucleotide with adenine (A) base inserted between 14th and 15th nucleotide. Ninth nucleotide changes from T to C.
Where is the substitution indicated on the original DNA strand? May you please Write it out and bold the nucleotide.
Given below is a DNA sequence as well as its corresponding mRNA and protein amino acid sequences. If in given DNA sequence a nucleotide is deleted or inserted or substituted, what types of mutations these changes may result? Show these changes and resulting mutations by using given sequences.
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA template strand.DNA Strand: TCT AAC TAT CCC CTA Third codon change from TAT to TAG. Second codon change from AAC to ATC. Nucleotide with adenine (A) base inserted between 14th and 15th nucleotide. Ninth nucleotide changes from T to C. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.
The illumina method of sequencing uses a unique type of nucleotide building block. What is the specific characteristic of this type of nucleotide that is important for this method of sequencing? How is the sequence of a fragment of DNA determined using this method? (USE THIS LINK AND WRITE ANSWERS IN YOUR LANGUAGE PLEASE DON'T COPY SAME AS GIVEN IN SITE https://www.mybiosource.com/learn/testing-procedures/dna-sequencing/
A student has drawn an enlarged portion of a DNA “ladder” model to show two of the nucleotides in greater detail (in the same orientation as they would occur in the ladder model). Which two nucleotides did the student draw?
If the sequence T-A-C-C-C-T appears on the informational strand of DNA, what sequence appears opposite it on the template strand? Label your answer with 3′ and 5′ ends.
Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand. First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide.