You have obtained a sample of DNA, and you transcribe MRNA from this purify it. You then separate the two strands of the DNA and analyze the base com each strand and of the mRNA. You obtain the data shown in the table below. Which DNA strand is the g strand? A G C DNA Strand #1 19.1 26.0 31 23.9

Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…

A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

A:

Q: Fill in the Amino Acids the original strand of DNA and its matching RNA strand will code for. TAC…

A: When DNA encodes mRNA then this process is called transcription. When mRNA encodes protein then this…

Q: Will the top or bottom DNA strand be the template for lagging synthesis

A: DNA replication is the process in which the DNA is copied to form two new sets of DNA as the cell…

Q: If a piece of DNA contains 22% adenine (A), what percentage will be cytosine (C)? 28% 44% 22%…

A: According to the Chargaff' rule, the amount of Adenines is equal to Thymine and the amount of…

Q: If a strand of DNA has the sequence CGGTATATC, then the complementary strand of DNA has the sequence…

A: Every living organism has Deoxyribonucleic acid (DNA). DNA has a recipe for synthesizing proteins.…

Q: The following is a section of DNA removed from a cell nucleus: 5'…

A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up…

Q: If one strand of DNA had the sequence "ATTCCGGATAC", what is the sequence of the other strand

A: To make a stable double helix, the two strands of DNA are antiparallel i.e. one strand runs opposite…

Q: The direction of MRNA molecule synthesis is . Select one: O a. From DNA strand that starts with 5' O…

A: BASIC INFORMATION TRANSCRIPTION  It is the process in which the genetic information present on one…

Q: a)  One DNA strand of Chromosome #12 has the following nucleotide sequence: TAC/CGC/CCT. What…

A: DNA is a double stranded helical structure present inside the nucleus. It acts as a hereditary…

Q: A nucleotide sequence in a segment of a DNA information strand is given here. Sketch (A) the…

A:

Q: Can you give further explanations regarding this topic? We are about to tackle this in our next…

A: Our DNA is made up of four bases which are A= Adenine, C= Cytosine, G= Guanine, and T= Thymine. Here…

Q: How do the sugars of RNA and DNA differ? a. RNA has a six-carbon sugar; DNA has a five-carbon sugar.…

A: RNA and DNA are polynucleotides made up of repetitive units of nucleotides. The nucleotide is…

Q: Give the complementary strand of DNA to the following strand, and then the RNA strand based off the…

A: DNA is made of two strands linked together by hydrogen bonds. Complementary base pairing occurs…

Q: How many nucleotides are in 12 mRNA codons? a. 12 b. 24 c. 36 d. 48

A: The three-letter nature of codons means that the four nucleotides found in mRNA are A, U, G, and C.

Q: DNA strand with the sequence 3’ AACGTAACG 5’ is transcribed. What is the sequence of the mRNA

A: Messenger RNA (mRNA) is a single-stranded RNA molecule that is complementary to one of the DNA…

Q: You obtain a sample of double-stranded DNA and transcribe mRNA from this DNA. You then analyze the…

A: mRNA stands for "messenger RNA." The nucleus uses the nucleotide sequence of DNA as a template to…

Q: If a sequence of bases on a DNA molecule is GATTACA, what would the complimentary mRNA strand look…

A: DNA replication is the process of the formation of identical copies of DNA.It occurs in nucleus.…

Q: If a protein was made up of 12 amino acids, how many nucleotides would make up the DNA message…

A: DNA( Deoxyribonucleic acids) is made up of two polynucleotide chain that winds around each other and…

Q: Give

A: Introduction:- The central dogma of biological sciences explains how genetic information is…

Q: A strand of DNA runs the following direction with the following base sequence: 3'-AUG CCC CAG TTA -…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: The sequence of mRNA made using the DNA double helix shown below is (Select ] The sequence of…

A: Introduction Protein synthesis is a two step process. In the first step, a molecule of mRNA is…

Q: equence of nucleotides in a DNA strand is CAT TAG CAT CAT GAC, what will be the base sequence in…

A: Given: CAT TAG CAT CAT GAC: Sequence of nucleotides in a DNA

Q: The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to…

A: Replication is the process of the formation of identical copies of DNA. It takes place in the…

Q: What is the base sequence of the mRNA synthesized from the following DNA template strand?…

A: In order for a gene to be converted into a functional protein, two processes must take place namely…

Q: A non-coding DNA strand has the sequence below: GTACCGATATAATCGGGCTA What is the MRNA sequence that…

A: Noncoding DNA sequences are DNA sequences that do not encode protein sequences in an organism.…

Q: If the DNA strand has nitrogenous base sequence ATTGCC, the mRNA will have?

A: The transcription is a process of conversion of DNA to mRNA using RNA polymerase enzymes which…

Q: Create the complementary strand for the DNA strand. ATTTGGTT

A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…

Q: 1. One strand of DNA has the base sequence: CGATTGGCAGTCAT. Determine the sequence of bases in the…

A: The sequence of bases of complementary mRNA from DNA strand can be determined as follows: DNA  mRNA…

Q: If one DNA strand has the nucleotide sequence below, what is the nucleotide sequence on its…

A: DNA and RNA are the two types of nucleic acids. Deoxyribose nucleic acid (DNA) is present in all…

Q: What would be the mRNA strand if the DNA strand reads: T A C C G A G T C A C G?

A: The process of transcription starts as the DNA of a gene serves as a template for complementary…

Q: Fill in the blank with the most appropriate term that is described by the following statement:…

A: Transcription  Cellular process in which RNA is synthesized using DNA as a template known as…

Q: If a sequence of bases on a DNA molecule is GATTACA, what would complimentary MRNA strand look like?…

A: The sequence of bases on a DNA molecule GATTACA the mRNA sequence will be CUAAUGU. Option B

Q: Determine what amino acid will be formed from the given DNA strand below:…

A: Determine what amino acid will be formed from the given DNA strand below:…

Q: Each new double helix will contain ___________ strand of DNA from the parent strand and ____________…

A: The method of replicating a double-stranded DNA molecule into two identical DNA molecules is known…

Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…

A: Introduction According to Chargaff's rules, DNA from any cell of any organism should have a 1:1…

Q: Using the figure below, which end of the double helix,"A" or "B", would be considered the 5 prime…

A: Introduction  DNA is an organic molecule that includes genetic information as well as instructions…

Q: Which of the following statements best summarizes the differences between DNA and RNA? A) DNA is…

A: There are two main types of genetic materials: DNA RNA

Q: Given the following sequence of nucleotides of a template DNA strand, predict the sequence of mRNA…

A: The DNA nucleotide sequence given above is- 3' CGTACGCCGAGACGTCAAC 5' (Template DNA strand) The mRNA…

Q: Use the images to identify the amino acid sequence with the following DNA sequence (hint: transcribe…

A: DNA is transcribed to form mRNA. This mRNA is used as a codon for the formation of amino acid…

Q: Following transcription, the RNA has a complementary sequence of which of the following? Question 9…

A: The process of copying of DNA segment onto an RNA using enzymes and nucleotides is called as…

Q: If you have 30 MRNA bases, how many amino acids would that code for? O 10 3 1

A: A triplet codon is where each codon consists of three, nonoverlapping, nucleotides.  The code is…

Q: Given the following strand of DNA, find: 1. the complementary DNA strand 2. the mRNA 3. the TRNA 4.…

A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…

Q: Using the example above, transcribe the following DNA strand into mRNA and translate that strand…

A: During transcription, the enzyme RNA polymerase uses DNA as a template to produce a pre-mRNA…

Q: Select the best answer or answers from the choices given: If DNA has a sequence of AAA, then a…

A: The nucleotides are formed by crosslinking three chemicals namely orthophosphoric acid (H3PO4),…

Q: Describe the synthesis of the lagging strand of DNA. Describe the synthesis of the leading strand of…

A: Answer. DNA replication is a process that takes place inside the nucleus of the cell. During…

Q: You obtained a sample of double-stranded DNA and transcribe mRNA from this DNA. You then analyse the…

A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.