What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC-5O 3- GCCTACGGGCATATG -5O 5-GCCTACGGGCATAAG -3O 5- GCCTACGGGCATATG-3O3-CGGATGCCCGTATAC -5

Name: What will be the newly synthesized DNA from the template given? DNA T
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC-5O 3- GCCTACGGGCATATG -5O 5-GCCTACGGGCATAAG -3O 5- GCCTACGGGCATATG-3O3-CGGATGCCCGTATAC -5

DNA replication :- It is the formation of a new DNA from a pre existing DNA. The DNA so formed is…

Answered: What will be the newly synthesized DNA…

Science

Biology

What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGELLGTATAL -5 O 3-GCCTACGGGCATATG -5 O 5-GCCTACGGGCATAAG -3 O5-GCCTACGGGCATATG-3 O3-CGGATGCCCGTATAC -5

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 1SQ

See similar textbooks

Similar questions

Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3 to 5 (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? template: PAGGCTCGOH new strand:
n gel electrophoresis of DNA, the different bands in the final gel form because the DNA molecules _______. a. are from different organisms b. have different lengths c. have different nucleotide compositions d. have different genes
Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’
Match the terms appropriately. ___ nucleotide ___ clone a. nitrogen-containing base, sugar, phosphate groups ___ autosome b. copy of an organism ___ DNA polymerase c. does not determine sex ___ mutation d. injects DNA ___ bacteriophage e. replication enzyme ___ semiconservative replication f. can cause cancer g. something old, something new ___ DNA ligase h. seals gaps and breaks
Cloning Genes Is a Multistep Process Which enzyme is responsible for covalently linking DNA strands together? a. DNA polymerase b. DNA ligase c. EcoRl d. restriction enzymes e. RNA polymerase
During proofreading, which of the following enzymes reads the DNA? primase topoisomerase DNA pol helicase
From the following DNA template, which sequence is synthesized by RNA Polymerase? 5’- T – C – C – T – A – A – G – A –3’ Group of answer choices 5’- A – G – G – A – T – T – C – T –3’ 5’- U – C – C – U – A – A – G – A –3’ 3’- A – G – G – A – U – U – C – U –5’ 3’- T – C – C – T – A – A – G – A –5’ 3’- T – G – G – A – T – T – C – T –5’
Which DNA polymerase in prokaryotes is involved in the replacement of primers with deoxynucleotides? a.DNA-Pol I b.DNA-Pol II c.DNA-Pol Ill d.DNA-Pol IV
Write out the resulting DNA molecules after the following double stranded DNA molecule is digested with EcoRI: 5’-ATGTTAGAATTCTACGTCGAATTCAAATTT-3’ 3’-TACAATCTTAAGATGCAGCTTAAGTTTAAA-5’
Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'
1. (a) What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA Template 3 - ATTGCGGATGCCCGTATACG -5 3 - AUUGCGGAUGCCCGUAUACG -5 5 - AUUGCGGAUGCCCGUAUACG -3 5 - AUUGCGGAUGCCCGUAUACG -3 3 - UAACGCCUACGGGCAUAUGC -5 (b) What will be the anticodons that will arrive in the translation of mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 "AAU, AUG, CGG, AUG, CCC, GAA" "UAC, GCC, UAC, GGG, CAA" "AUG, CGG, AUG, CCC, GAA" "UUA, UAC, GCC, UAC, GGG, CAA"
What is the sequence of the newly synthesize DNA segment if the template strand has the following sequence:3'-ATGGCCTATGCGAT-5'