Below is a sequence of mRNA. Use it to answer the questions below. 5' - AACUCCAUGCUUAUUGCUGGCUGAAAUCGACG-3' How many amino acids will be present in the protein? Write the order of the amino acids in this protein.

Below is a sequence of mRNA. Use it to answer the questions below. 5' - AACUCCAUGCUUAUUGCUGGCUGAAAUCGACG-3' How many amino acids will be present in the protein? Write the order of the amino acids in this protein.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Related questions

Q: What molecule catalyzes the formation of proteins

A: The protein synthesis process is a process where amino acids are formed by reading the frame of the…

Q: how does a sequence of DNA nucleotides in a gene indirectly determines the structure of the protein…

A: DNA is made up of nucleotides. The sequence of DNA that codes for a functional product either in the…

Q: DNA is a chemical that cells use to store information. Describe how information is encoded in DNA,…

A: DNA is Deoxyribo Nucleic Acid which is a complex molecule which consists of two polynucleotide…

Q: Sequence of nucleotides in MRNA|AUGCGUUCAUGGACU Sequence of amino acids in protein

A: Sequence of nucleotide in mRNA AUGCGUUCAUGGACU is given .

Q: The arrow points to which type of structure on the RNA molecule depicted below? 40 Multiple Choice…

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: What regulates the process of transcription and translation; compare and contrast these processes.

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: Which is a feature of mRNA processing in eukaryotes? removal of exon sequences addition of a…

A: Processing of mRNA Until introns are removed and the mRNA is considered ready for translation,…

Q: In a detailed diagram show and explain all the locations where RNA may regulate protein translation.…

A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…

Q: The law of complementary base pairingdescribes the way the bases in an mRNAcodon pair up with the…

A: Translation is a process in which the messenger RNA or mRNA gets translated into protein. The…

Q: Which statement BEST DESCRIBES the genetic code? A. There can only be one codon for multiple amino…

A: 3 nucleotides ( triplet ) formed a single codon . Each codon code for specific amino acid . There…

Q: a) Are codons found in DNA or RNA? b) How many bases are in a codon? c) Give an example of a codon.

A: A codon is a DNA or RNA trinucleotide sequence that refers to a certain amino acid.

Q: Figure out which RNA and DNA would code for the following sequence of amino acids (multiple answers…

A: The transcription is the process by which RNA is generated from the DNA template. This process…

Q: Fill in the blank with the most appropriate term that is described by the following statement:…

A: Introduction Ribonucleic acid, or RNA, is a long, single-stranded protein-processing chain found in…

Q: Use the figure to answer the question. 5' tRNAS , which are single-stranded, have what is described…

A: Introduction :- t-rna (transfer RNA) which is used in translation i.e protien synthesis.Its…

Q: nfer what the result would be if the A site on the ribosome was not in the correct conformation…

A: The biochemical substance that is carried from the preceding generation to the succeeding generation…

Q: Select the best answer or answers from the choices given: The information sequence that determines…

A: Introduction DNA and RNA are the main genetic material found in all the species irrespective of…

Q: Choose the DNA sequence from which this mRNA sequence wastranscribed: 5′-AUACGAUUA-3′.a.…

A: Ans: DNA: It is the life molecule which is known as Deoxyribonucleic acid. mRNA: The sequence of…

Q: How many “letters” of an RNA molecule, in sequence,does it take to provide the code for a single…

A: Ribonucleic acid (RNA) are polymeric organic molecules, which are essential for carrying out various…

Q: Briefly describe (two or three sentences) the role of tRNA in building a protein from mRNA.

A: Answer

Q: how does a dna molecule code for a protein

A: Deoxyribonucleic acid or DNA is a molecule that comprises of two polynucleotide chains that wound…

Q: During protein synthesis, one amino acid binds to RNA molecules. a) What is this RNA molecule? b)…

A: The process of formation of Amino acids from mRNA molecule is known as translation.

Q: Use the following DNA sequence, and write the resulting messenger RNA sequence

A: When DNA makes it's two copies then this is called replication. When DNA is converted into RNA then…

Q: Explain how mRNA and tRNA work together to get amino acids into their correct places in the protein.

A: The translation is a process through which the polypeptide chain is synthesized based on the…

Q: Which form of RNA acts as a blueprint for polypeptide biosynthesis by the ribosome? O a. FRNA O b.…

A: Messenger RNA (mRNA) is a type of RNA that transports the protein blueprint from a cell's DNA to its…

Q: Sometimes knowing the DNA sequence of a gene that codes for a protein does not tell you the amino…

A: A DNA sequence is copied into a messenger RNA in the process of transcription that occurs in the…

Q: A. Name 3 nonpolar amino acids found in proteins (give name and 3 letter code) B. Name 2 polar…

A: A) Non-polar amino acids: The side chain comprises mostly of hydrocarbons. B) Polar uncharged amino…

Q: Explain the types of RNA & explain how they play role in the process of protein synthesis.

A: Explain the types of RNA & explain how they play role in the process of protein synthesis.…

Q: ______ molecules deliver amino acids to the site of protein synthesis. a. DNA b. mRNA c. rRNA d.…

A: The process of translation occurs in which proteins are synthesized with the incorporation of amino…

Q: Explain how the function of RNA differs from the function of DNA.

A: A gene is the fundamental physical and functional unit of heredity. Genes are comprised of DNA. A…

Q: Write the sequence of bases in the sense strand of DNA that would result in formation of that…

A: DNA is converted to RNA by the process of transcription by an enzyme known as RNA polymerase. The…

Q: Which mRNA would be made if the sequence of the DNA coding strand is GAC? O GAC O GTC O GUC O CUG

A: Amino acids are organic compounds with amino and carboxyl functional groups as well as a side chain…

Q: From what DNA base sequence was the following mRNA sequence transcribed? 5’ – UUCGAG – 3’

A: If the 5'-UUCGAG-3' is the the sequence for mRNA, then the DNA base sequence will be 3'-AAGCTC-5'

Q: A scientist while sequencing mrna identifies the following strand…

A: Translation is the process by which polypeptides are synthesized from a mRNA transcript which is…

Q: Choose the combination of answers that most accurately completes the statement. Which of these…

A: The largest and broadest category of all groups in the classification of life is known as domain. At…

Q: 1. Decoding mRNA into amino acids is called translation.

A: above given statements are about transcription, translation process and how amino acids makes a…

Q: Draw a picture showing the sticky ends that are produced by BamHI digestion (BamHI cuts between the…

A: Enzymes that can cleave the DNA at specific sites are known as restriction enzymes. There are two…

Q: Use the figure of a tRNA to answer the following question: -E D Aminoacyl TRNA adds an amino acid to…

A: RNA is a type of nucleic acid present in the cells.

Q: If you have 30 MRNA bases, how many amino acids would that code for? O 10 3 1

A: A triplet codon is where each codon consists of three, nonoverlapping, nucleotides. The code is…

Q: The end result of BOTH transcription and translation of the DNA sequence AAGCTGGGA would result in?…

A: The genetic material in most higher organisms and some viruses in DNA. It is composed of a sugar…

Q: Speculate why the half-life of mRNA is short, while the half-lives of rRNA and tRNA are long.

A: RNA is a genetic material and basically are of three types rRNA, mRNA and tRNA.

Q: Discuss DNA to RNA transcription in a simple way (

A: Definition : Process of copying a segment of DNA into RNA is known as Transcription. In simple,…

Q: Refer to the genetic code table and the mRNA sequence below to complete this question: U C U G A U…

A: Question - Refer to the genetic code table and the mRNA sequence below to complete this question: U…

Q: Use your genetic code (codon) table to answer this question: A tRNA has the anticodon GCU. Which…

A: The anticodon of any one tRNA fits impeccably into the mRNA codon that codes for the amino corrosive…

Q: Which enzyme links amino acids together? (a) ribozyme (b) peptidyl transferase (c) DNA…

A: The organic compound that will combine and form the protein is called an amino acid. Amino acids are…

Q: Which statement correctly describes a codon? a sequence of three nucleotides that may code for one…

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Q: Use the model to answer the following questions. 1. Which of the arrows (1 or 2) represents…

A: Transcription is the process of formation of mRNA on DNA template catalyzed by RNA polymerase.…

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

(a) Write the complementary base sequence for the matching strand in the DNA section shown below:. 5’ – A T G T T A C T A G T C – 3’ (b) The following section of DNA is used to build an mRNA for a protein: 3′—AAG—CTT—CTC—5′. What is the corresponding mRNA sequence?
1). The sequence of mRNA made using the DNA double helix shown below is 2). The sequence of protein made using the mRNA is
Select the best answer or answers from the choices given: If DNA has a sequence of AAA, then a segment of mRNA synthesized on it will have a sequence of (a) TTT, (b) UUU, (c) GGG, (d) CCC.
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
If a protein is made up of 1000 amino acids 1) How many nucleotides will its mRNA contain between (and including) the start and stop codon? _____ 2) How many codons will this mRNA contain? _____ 3) How many tRNA molecules will be needed to make that protein? _____
1. Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the role of tRNA molecules in protein translation.c. Define the following terms:1. codon 2. anticodon. Explain how a codon is used in the process of translation.
Proteins range in size from ~50 amino acids to more than 1,000 amino acids. Given that the typical amino acid is about the same size as a nucleotide, the gene and mRNA for a protein will be ______ that protein. A. smaller than B. larger than C. about the same size as D. there is no way to tell
Once translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?
What is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3' sequence? a5'-ATCGGATTC-3' b5'-GAAUCCGAU-3' c5'-GAATCCGAT-3' d5'-UAGCCUAAG-3'
Determine the identity of the N-terminal amino acid after reconstructing the intact protein. Why is this answer correct and why are the others incorrect? A. Asp B. Ser C. Glu D. Ile
A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to 5’ACGTCATGCGATAGTGCGTAAACTA3’ Describe the effect of this mutation on the protein, and give the name of the type of mutation.
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.