Draw a picture showing the sticky ends that are produced by BamHI digestion (BamHI cuts between the two G nucleotides in the sequence 5’-GGATCC-3’, on both top and bottom strands).
Q: GCA UGC CGA UAC
A: 1. The tRNA anticodons for the amino acid sequence shown above is - GCA UGC CGA UAC
Q: Write the sequence of the complementary DNA strand that pairs with each of the following DNA base…
A: The deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains. It coils around…
Q: A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What…
A: Bacterial DNA is contained within the bacterial chromosome along with several RNA and protein…
Q: If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is…
A:
Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…
A:
Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…
A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…
Q: If the DNA has a triplet code of CAG in one strand. What is the complementary triplet code in the…
A: Please post MCQ's as separate questions.
Q: Convert the following sequence into protein strand using one letter code:…
A: The protein is made by the post-translational modification of peptide chains, and these peptides are…
Q: If you had the RNA sequence below: 5' UUUGGAG3 and you were going to make a piece of DNA that would…
A: Uracil is the unique base in RNA, whereas in DNA it is thymine.. The strands runs antiparallel; one…
Q: If the template DNA is 3' A GCTAC5' then the mRNA sequence is
A: Ans- As mentioned the DNA template 3’ – A G C T A C – 5’ The mRNA sequence will be – a) 5’…
Q: A section of an mRNA has the following nucleotide sequence: ACU UGC AGU GGU GUA For the mRNA…
A:
Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…
A: The central dogma is a metabolic process where the DNA acts as genetic material and transcripted…
Q: Why is RNA polymerase a good name for this enzyme? Explain each part of the name: RNA, polymer and…
A: The enzyme that is needed for the formation of RNA from DNA is known as RNA polymerase. At the time…
Q: What is the sequence of the DNA template strand from which each of the following mRNA strands was…
A: As we know that the DNA carries the information, which is translated into the mRNA and transcribed…
Q: Give the translation of the segment of a polypeptide chain below. Specify your template strand.…
A: Transcription is the process by which RNA polymerase read out DNA and make m-RNA then mRNA is…
Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…
A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…
Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second…
A: The mRNA (messenger ribonucleic acid) is synthesized from a DNA (deoxyribonucleic acid) template.…
Q: Label the 5' and 3' end of each nucleotide and approximate where the start point (+1) would be on…
A: The process shown here is called transcription. In this process a molecule of mRNA is synthesized…
Q: Shown below is the " sense" strand of DNA. Second letter U What is the amino acid sequence that…
A: Introduction :- Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…
Q: A strand of DNA containing the repeating sequence TAC GCT TTT GCG ATAACT could code for which of the…
A: When DNA is converted into RNA then this is called transcription. When mRNA encodes protein then…
Q: In the DNA sequence,the bottom strand is a template strand.if the base pair
A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…
Q: This is the non-template strand of a double stranded DNA. RNA is transcribed from using one of the…
A: DNA serves as the genetic material and carries genetic information from one generation to another.…
Q: Ribonucleotide reductase converts UDP into dUDP. True Or False
A: Ribonucleotide reductase is an enzyme which helps in the process of DNA synthesis, by synthesis of…
Q: Consider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand…
A: A gene mutation that results from the substitution of one base pair of another. TATGAAAGT non…
Q: If given the following coding strand of DNA, what is the mRNA? What tRNA will be present? (hint -…
A: DNA is a hereditary molecule made up of two polynucleotide chains lies in the nuclues of all…
Q: Write down the sequence of compliimentary strand in 5'->3' direction?
A: The deoxyribonucleic acid (DNA) is a hereditary material that is found in almost all living…
Q: using the genetic code provided what would be the corresponding polypeptide sequence for the DNA…
A: DNA is a double helical complex molecule which encodes all the information regarding an organism. It…
Q: Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the…
A: Restriction endonucleases cut double stranded DNA at specific site or near specific site and form…
Q: Which of the following mutations of the DNA sequence TTT TÁC ÁCT would potentially have the least…
A: The genetic information from the DNA is first transcribed into mRNA. The mRNA contains codons, which…
Q: What is the base sequence of the mRNA synthesized from the following DNA template strand?…
A: In order for a gene to be converted into a functional protein, two processes must take place namely…
Q: Which of the following sequences in the coding strand of the DNA could code for this peptide? Select…
A: Amino acids are coded by codons (trinucleotide sequences of DNA or RNA). Specific codons code for…
Q: Table 8.2: Transcription and translation of the first 7 codons in the B-globin chain of hemoglobin.…
A: Change in the DNA sequence can causes alternation of the amino acid sequence. This can causes an…
Q: Write the sequences of bases in the sense strand of DNA that resulted in the mRNA in Problem .
A: DNA is a double helical molecule, in which two complementary strands are held together with the help…
Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…
A:
Q: Draw the structure of the nucleotide represented by dTMP.
A: Nucleotides are organic molecules which is composed of a sugar moiety, a nitrogenous base, and a…
Q: Which of the following mRNA codons could be changed to a stop codon by a single base pair…
A: A codon consists of three-nucleotides (A, G, C, or U) of RNA and carries the genetic information.…
Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…
A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…
Q: A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will…
A: During transcription process, the strand used as template is known as template strand which sets in…
Q: Write the base sequence that would be sticky with the sequence T-A-T-G-A-C-T.
A: Erwin Chargaff discovered the complementary base pair rule. according to the chargeoff base-pairing…
Q: Using the table of genetic code, choose the CORRECT protein sequence that will be produced from the…
A: Genetic code is a triplet code called a codon. There are 64 codon out of which three codon do not…
Q: Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA…
A: They enhance the rate of a reaction without being consumed or modified during the reaction.…
Q: A peptide has the sequence NH 2-phe-pro-lys-gly-phe-pro-COOH. Which of the following sequences in…
A: Correct answer :- 5' TTT-CCC-AAA-GGG-TTT-CCC ( option B is correct.)
Q: Write the decarboxylation process for: a) serine, b) histidine, c) tryptophan.
A: Amino acids are biomolecules with a central carbon atom attached to an amine, carboxyl, and an R…
Q: Give the mRNA and amino acid sequence from this DNA strand: CCATTAACCTTACTGCTGGCTAAATTCGTTGCT
A: DNA => Transcription => mRNA => Translation => Protein Given a sequence of DNA:…
Q: The first nucleotide in mRNA that will be synthesized from DNA below is: 3'-…
A: During the transcription process RNA is produced from the DNA within the nucleus of eukaryotic cells…
Q: A DNA nucleotide triplet that codes for the amino acid proline is a.
A: Answer: Amino Acids are the monomers of protein molecules which has both carboxyl and amino group…
Q: A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon…
A: ANSWER;- 3'UCA 5' Explain;- Transcription is a process of a particular DNA sequence being copied…
Q: A DNA antisense strand contains the following nucleotide base sequence: CGA TTT GGT TGA From this,…
A: INTRODUCTION The RNA polymerase enzyme will read the DNA strand and make the mRNA molecule.
Q: Using the genetic code provided what would be the corresponding polypeptide sequence for the DNA…
A: Proteins are the building blocks of the body. Proteins are made up of amino acids. All the…
Q: Among the different types of amino acid substitution, which is the most deletetrious? a.…
A: Mutations are changes in the architecture of a gene, which is the fundamental unit of inheritance.…
Draw a picture showing the sticky ends that are produced by BamHI digestion (BamHI cuts between the two G
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will be encoded by this sequence? 5′ –ATGATACTAAGGCCC–3′A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What amino acids are encoded by this sequence?Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence5'-CTTGGATATC-3'
- Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.using the genetic code provided what would be the corresponding polypeptide sequence for the DNA template sequence 5’-TAT-GGC-ATG-3’? Ile-Arg-Pro His-Ala-Ile Tyr-Gly-Met Val-Arg-Tyr Ile-Pro-TyrFor the following DNA bases, give the complementary mRNA code that would be transcribed from these bases: AGCTAATCGGCTACCAGGTACGGATATTCC
- What will be the sequence of mRNA produced by the following stretch of DNA? 3' ATCGGTTAAC 5' TEMPLATE STRAND 5' TAGCCAATTG 3' CODING STRAND 1. 5' AUCGGUUAAC 3' 2. 3' GUUAAGGCAU 5' 3. 3' GUUAACCGAU 5’ 4. 5' UAGCCUUAAC 3'List the DNA bases that will complementary base pair with the following sequence: A-G-C-T-A-C-GOne strand of DNA has the base sequence as shown below. Complete the transcription and translation of this strand. Non template strand: 5' A T G T A T G C C A A T G C A 3’ What is the amino acids?
- Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’A polypeptide has the following sequence: Phe-Pro-Lys-Gly. Which of the following sequences in the coding strand of the DNA could code for this peptide? Select all that are correct. A) CTT-GGG-AAA-CCC-TAG B) TTC-CCG-AAG-GGA C) TTT-CCC-AAA-GGG-TGA D) UUC-CCA-AAG-GGU E) TTC-CCA-AAG-GGC F) AAA-GGG-TTT-CCC-ATTUsing the genetic code, indicate which polypeptides would be synthesized if poly-UGG were used in a synthetic RNA? poly-W poly-Y poly-G poly-V