The initiation factors a. help assembling both ribosomal subunits with mRNA and initiator tRNA b. help with the peptide bond formation c. help starting the translation elongation d. are responsible for the initiation of ribosome translocation

The initiation factors a. help assembling both ribosomal subunits with mRNA and initiator tRNA b. help with the peptide bond formation c. help starting the translation elongation d. are responsible for the initiation of ribosome translocation

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 12SQ

See similar textbooks

Related questions

Q: Examine the following base sequence – 5’ UGA 3’. It represents the anticodon region of a particular…

A: Answer - This tRNA would carry the amino acid Serine to the ribosome. mRNA carries codon. tRNA…

Q: After being irradiated, the gene coding for the E site is mutated, causing the E site to have a…

A: The process of the formation of RNA from DNA is called transcription. The process of the formation…

Q: Use the pre-mRNA sequence shown below to answer the following questions. MRNA:…

A: Splice sites are recognized by GU (5' splice site) and AG (3' splice site), which signals the…

Q: Briefly explain the importance of the 5'-cap in the translation process. Do not simply define the…

A: Introduction :- During transcription, the 5' cap is inserted to the first nucleotide in the…

Q: A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that…

A: The normal mRNA is 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ The bases in bold form the start codon.…

Q: a. In your claim words, depict the contrast between ρ-dependent and ρ-independent end of translation…

A: ρ-dependent is basically a translation termination mechanism occuring in prokaryotic cells. Here ρ…

Q: Provide the correct sequence of steps in each process described below. Write the letters in series…

A: Translation involves “decoding” a messenger RNA (mRNA) and using its information to build a…

Q: Synonymous mutations are: O a. a change from a stop codon to an amino-acid coding codon. O b.…

A: Genes are the units (physical and functional) of heredity, made up of DNA or deoxyribonucleic. They…

Q: . The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…

A: Arginine is coded by six mRNA codons.

Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU -- 3' Write the amino acid sequence…

A: The nucleotide sequence in mRNA is translated to an amino acid by rules of genetic code. A codon…

Q: Mutation of which of these sequences would have an effect on translational initiation? A. 3’ UTR…

A: Introduction Prokaryotic transcription is the process by which prokaryotic genetic material is…

Q: 7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide…

A: DNA to mRNA is transcription and mRNA to protein is translation.

Q: which signal serves a similar function as the Shine-Dalgarno Sequence in prokaryotes? A. The…

A: The Shine–Dalgarno sequence is a ribosomal binding site in prokaryotic mRNA, generally located…

Q: 9The table opposite shows the triplet codes for the 20 amino acids involved in protein synther A…

A: Codons are three DNA sequence triplets that code for specific amino acids and there are a total of…

Q: a. The right side shows the ribosome with an empty A site aligned with the codon 5’UAU 3’. The next…

A: When the DNA that is already transcribed to RNA inside the cell ribosomes helps this mRNA to…

Q: The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was…

A: The synthesis of RNA (ribonucleic acid) from DNA (deoxyribonucleic acid) by the enzyme RNApolymerase…

Q: 1. Transcription: a)State the role of RNA polymerase in gene transcription.b. Explain why the DNA…

A: Transcription is the process of copying information from a strand of DNA to a newly synthesized…

Q: Choose best match of the events that occur during translation with their locations in the E. coli…

A: Translation is the process by which the genetic code on messenger RNA (mRNA) molecules is decoded to…

Q: 1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ mRNA: polypeptide chain:

A: (According to our regulations, we are required to answer only the first question in case of multiple…

Q: During translation, ____________ is the step in which new t-RNA is attracted to the ribosome (a)…

A: Translation is the process in which proteins are synthesized by ribosomes. Translation occurs after…

Q: A nonsense mutation Select one: a. results in a larger protein being produced from the mutated gene…

A: Introduction :- There are a number of disorders known to be caused by nonsense mutations, including:…

Q: During translation elongation, in which site do new tRNAs enter? a) D site b) E site c) A site…

A: DNA => Transcription => mRNA => Translation => Protein. Protein synthesis ( ribosome…

Q: Give the amino acid sequence of the protein encoded by the mRNA in Figure 15.21.

A: Translation is the process of formation of protein by decoding the nucleotide sequence of an mRNA.…

Q: List the differences in the loading of the tRNA and its alignment with the mRNA between the…

A: Translation It is defined as the process of translating the sequence of mRNA molecules to the…

Q: In the triplet-binding assay of Nirenberg and Leder, an RNA triplet composed of three bases was able…

A: Introduction In 1964, two eminent scientists Marshall W. Nirenberg and Philip Leder carried out the…

Q: At least one nonsense suppressing tRNA is knownthat can suppress more than one type of…

A: tRNA is a transfer ribonucleic acid. It is a type of RNA which decodes the messenger RNA and form a…

Q: Translational control is usually aimed at preventing the initiation of translation. With regard to…

A: The process of translating the sequence of mRNA into an amino acid sequence is called translation.…

Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. a) What…

A: According to the central dogma, the information flows From DNA to proteins. DNA is transcribes into…

Q: A mRNA strand is 5’ to 3 across the translation initiation complex. The start codon is ____ And…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: briefly explain the importance of the degeneracy of the genetic code in the translation process.

A: The genetic code can be defined as a collection of rules that living cells use to translate…

Q: A. If a nascent mRNA is composed of 540 nucleotide bases and its introns (2/3 of the total number of…

A: .If m-RNA is composed of 540 nucleotides and 2/3 introns are removed during RNA splicing then we…

Q: Your labmate gives you a gene with the following sequence of the coding strand for the first 5 amino…

A: given DNA strand first form the complimentary starnd by changing A - T and G-C for the strand 3' to…

Q: What is an example of a post translational modification? a. Poly (a) tail b. 5' capping c.…

A: Following protein production, covalent and typically enzymatic modifications to proteins are…

Q: The 3 major forms of RNA (mRNA, tRNA, & rRNA) interact during translation. b) Which of the 3 types…

A: RNA may be a single-stranded macromolecule that's composed of three main elements. The central dogma…

Q: The peptide bond formation a. occurs when two tRNAs are located inside the P and A site in the…

A: Given: The peptide bond formation.

Q: A scientist mutates eIF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of…

A: Selection of the AUG start codon for translation in eukaryotes is governed by codon-anticodon…

Q: A short RNA molecule was isolated that demonstrated a hyperchromicshift , indicating secondary…

A: Answer- The formation of mRNA from the coding strand of the DNA is called translation. It happens in…

Q: A partial DNA sequence, a partial MRNA transcript, and part of the CFTR polypeptide in a cystic…

A: Cystic fibrosis is a disesase that damage the cell producing mucus, sweat and other juices. in…

Q: a) What is genetic code and What are the properties of genetic code b) Explain the role of…

A: During the translation process, the genetic code from the mRNA is transcribed into amino acids and…

Q: Transcribe and translate the following sequence of DNA: ATGAAGTTACCC. There is a mutation that…

A: Transcription is the synthesis of pRNA with the template DNA. Translation is the synthesis of…

Q: The release factors RF1 and RF2 are required for

Q: Use the pre-mRNA sequence shown below to answer the following questions. MRNA:…

A: The intron boundary (5' splice site) generally starts with GU sequence. The consensus sequence of 5'…

Q: Comment on the accuracy of the aminoacylation during the charging of tRNA to ensure the fidelity of…

A: Amino acid activation or commonly known as tRNA charging, refers to the attachment of an amino acid…

Q: . Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…

A: The central dogma of life involves three processes. They are: Replication: - In this process,…

Q: Elongation factor __________ reactivates arrested RNA polymerase II

A: Molecular biology is the branch of science that studies the structure, composition, function, and…

Q: B. One strand of a section of DNA isolated from E. coli reads: (Assume no start codon is required as…

A: Deoxyribonucleic acid (DNA) is a macromolecule made of two strands that are complementary to each…

Q: Below is a picture of a ribosome. Name and give a function of all the “players” of translation found…

A: In molecular biology, when the ribosomes present in the cytoplasm or endoplasmic reticulum…

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

The initiation factors

a. help assembling both ribosomal subunits with mRNA and initiator tRNA

b. help with the peptide bond formation

c. help starting the translation elongation

d. are responsible for the initiation of ribosome translocation

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

a) Identify the current stage of the translation process shown in Figure 1 and name the anticodon sequence in tRNAb) State TWO immediate, main consequences when a stop codon reaches the E site.
Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protien
Explain why mature mRNA transcripts is a different size that pre-mRNA transcripts. Be sure to include the name of the protein-ribonucleotide complex that’s involved.
Below is a picture of a ribosome. Name and give a function of all the “players” of translation found in the picture. Explain what happens during the following steps of translation: Initiation: Elongation: Termination:
Because of _____, a tRNA may recognize more thanone codon
Based on image of protein (enzyme), need to know: a) Number of amino acids and length (Angstroms) of helix denoted as H2. b) Name the post-translational modification (PTM) the enzyme has underwent. c) Name chemical reagent to undo this PTM and number of equivalents of reagent needed.
a) What is genetic code and What are the properties of genetic codeb) Explain the role of translation elongation factors of E.coli.
Mutations: The codon GGA encodes the amino acid glycine. Identify the type of mutation for each of the following changes (name both the type of mutation and what the new codon would produce): GGA to GGG GGA to UGA GGA to GAGA GGA to AGA
Hi, Could you please comfirm the following question. I have selected option c) because tRNA is the the complimentary pairs of mRNA so I figured the oppside end of the tRNA would be the same as the mRNA. When I have tired to double check my answer, no tutor has selected this answer. Thank you in advance, Like mRNA, tRNA has a ribose sugar, U instead of T, and is single stranded. Unlike mRNA, which remains a long single strand of nucleotides, tRNA folds so that some areas pair up. The resulting structure has an anticodon on one end and a site for an amino acid to attach on the other end. There is base complementarity (A pairs with U and G pairs with C) between an mRNA codon and tRNA anticodon.If the amino acid lysine attaches to a tRNA, which of the following anticodons could be at the opposite end of the tRNA molecule? a. UUU and UUC b. AGA and AGU c. AAA and AAG d. UCU and UCA
Which choice best fits the blank? Refer to picture. The ribosome moves along the mRNA strand. In panels b, c, and d, new tRNAs carrying ___________. match up with the codons of the mRNA strand. After each tRNA locks into place, a peptide bond forms between the amino acid the tRNA is carrying and the amino acid already there. This process repeats until the end of the sequence is reached. A. ProteinsB. NucleotidesC. Amino Acids
Different types of mutations and how to use the genetic code table.
The codon UUU in an mRNA molecule which results in phenylalanine being inserted as the protein is made. Which will be a characteristic of this codon? a. The tRNA molecule that binds to the UUU codon must have an AAA anticodon. Nde ba e2? b. UUU could code for both phenylalanine and alanine during translation. c. The aminoacyl-tRNA synthetase for phenylalanine binds only the UUU codon. d. UUU is probably only one of several codons that code for phenylalanine.