Answered: For a DNA template strand containing…

For a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides from the 5' to the 3' end in the mRNA transcript?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 20QP: If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it...

See similar textbooks

Related questions

Q: Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA…

A: Cystic fibrosis is a hereditary disease, inherited in an autosomal recessive manner. The cystic…

Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: 4A.According to Watson-crick base-pairing rule- Double-stranded DNA is complementary in nature that…

Q: The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be produced…

A: Introduction Genes contains specific nucleotide sequences which can be transcribed into the mRNA by…

Q: Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5' A) What would be the protein…

A: Introduction A mutation is a change in the structure of a gene, which is the fundamental unit of…

Q: Below is a sequence of DNA.…

A: The process of identifying the coding region and the position of a gene in a genome is known as gene…

Q: What is the completing sequence of nitrogen- containing bases for a AGCCGTTAAC fragment of a DNA…

A: DNA base pairs are due to the formation of hydrogen bonds between the nitrogenase bases, purines,…

Q: If you had a protein that developed a mutation that changed its TEMPLATE strand from 5’GAT 3’ to…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: What is the sequence of the DNA template strand from which each of the following mRNA strands was…

A: As we know that the DNA carries the information, which is translated into the mRNA and transcribed…

Q: How often, on average, would you expect a type II restriction endonuclease to cut a DNA molecule if…

A: Restriction endonucleases are enzymes produced by bacteria that cut the DNA at a specific site known…

Q: Using the DNA strand shown here as a template, what will be the sequence of the RNA transcript? 5'…

A: A template is the strand that attach to the complementary strand via DNA polymerase and RNA…

Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second…

A: The mRNA (messenger ribonucleic acid) is synthesized from a DNA (deoxyribonucleic acid) template.…

Q: A small section of bacterial DNA antisense strand has the following nucleotide sequence: AAT CGG…

A: Option d

Q: What would be a primer sequence synthesized from the following DNA sequence: 5'-ACGTG-3'? out of…

A: DNA polymerase cannot start DNA replication on its own. They require short double stranded region to…

Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…

Q: DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ -Write the sequence of the RNA molecule that will be…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: What would happen to DNA repair in bacteria if MutH is mutated such that is cannot recognize the…

A: In prokaryotes , Mut H involved in mismatch repair syatem. Mut S can recognise mismatched…

Q: Given the Following DNA template, TAC CGC TCC GCC GTC GAC AAT ACC ACT, write out the…

A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…

Q: Given the following coding sequence for DNA, provide the sequence of the complementary(template)…

A: A nucleotide is a biomolecule that consists of a nitrogenous base (either a purine or a pyrimidine),…

Q: Please find the mRNA strand: Amino acid sequence How does the amino acid sequence from the base…

A: BASIC INFORMATION TRANSLATION It is the process in which protein is which formed from the…

Q: During DNA replication, the template sequence 5' ATAGGCC 3' would produce which one of the following…

A: Replication is a biochemical process by which the DNA is synthesized on itself. It is mode by which…

Q: For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’…

A: 4 codes are used by the DNA that areAdenine (A), Thymine (T), Guanine (G), Cytosine (C)RNA also…

Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five…

A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5…

Q: A template DNA strand coded for the following sequence: CTCAAGTTATGTATGTCCGATTCGCATGCGCT 1) What is…

A: DNA is the genetic material of the cell which gets transcribed into mRNA with the help of RNA…

Q: A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers are dashed…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: Consider the following sequence of DNA: 3'-TTA CGG-5' What dipeptide is formed from this DNA after…

A: The genetic information is present in the sequences of the DNA. The sequence of DNA that runs in the…

Q: The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What MRNA would be produced…

A: The transcription process enables an enzyme known as RNA polymerase to bind to the DNA and break…

Q: Below are several DNA sequences that are mutated compared with the wild-type sequence. Each is a…

A: Note - Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: If the DNA duplex for the beta chain of haemoglobin represented by the sequence…

A: Given the template strand in transcription unit is 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5' If the…

Q: In eukaryotic cells, the length of the transcribed RNA is almost equal to the corresponding DNA…

A: Eukaryotic cells are huge and sophisticated creatures having a nucleus encased within the nuclear…

Q: For the following DNA sequence: 3-CGATACGGCTATGCCGGCATT-5' The the sequence of the complementary DNA…

A: Complimentary base pairing Base pairing take place between a purine and pyrimidine. In DNA, adenine…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Introduction : Transcription is the process in which a DNA sequence is transcribed into an RNA…

Q: Given the template DNA strand 3’-TACCCTCAAGGGCAAACT-5’, provide the complimentary DNA strand, mRNA,…

A: DNA is the genetic material of almost all living organisms. The DNA is inherited from the parents…

Q: The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that…

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…

Q: List the sequences of RNA that would be transcribed from the following DNA template sequences.…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. It contain genes that…

Q: Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino…

A: For the synthesis of protein first template strand of DNA is made from coding strand of DNA.…

Q: Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’…

A: Of the two strands of DNA, the template strand or non-coding strand is used for transcribing an mRNA…

Q: If the recognition sequence of the restriction enzyme Hindlll is AAGCTT, then how many covalent…

A: The enzymes that are able to cut the DNA at specific sites are known as restriction enzymes. The…

Q: What enzymatic features of DNA polymerase prevent it from replicating one of the DNA strands at the…

A: The bacterial chromosome is usually circular in shape: hence it can be completely replicated by the…

Q: How are deoxyribonucleoside triphosphates (precursors of daughter DNA strands) and ribonucleoside…

Q: Is each of the following mutations a silent, missense, nonsense, orframeshift mutation? The original…

A: The mutation is a sudden, stable, and heritable change in the organism’s genome. It can occur due to…

Q: Using the figure below identify: What is a function of introns and exons? What is a role of mobile…

A: DNA is packed up compactly in the nucleus of a cell in close association with histone proteins…

Q: Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: Which of the following RNA sequences is an inverted repeat and can form a stem-loop structure?…

A: A single-stranded nucleotide sequence followed by its reverse complement at the downstream is called…

Q: The following represent deoxyribonucleotidesequences in the template strand of DNA:Sequence 1:…

A: DNA is a hereditary molecule found in cells that transmits genetic information from one generation…

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’, what is the sequence of the…

A: EXPLANATION: DNA utilizes four bases, adenine (A), guanine (G), cytosine (C), and thymine (T), in…

Q: For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’…

A: DNA is a double stranded helical structure composed of a template and coding strands. Template…

Q: 1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU…

A: DNA replication is a proces by which molecule of DNA is duplicated. DNA replication is necessary to…

Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: Blood is a body fluid that carries necessary nutrients and oxygen to the cells and transports…

Q: If the DNA molecule read its complementary strand as: TACGATCCGAACCAAACT, how would the m-RNA read…

A: The synthesis of m RNA and t RNA from DNA is called transcription. Thre ribosomes synthesize…

Concept explainers

Microbial Taxonomy

Taxonomy is the science of naming, classifying, and describing organisms. The taxonomy will include all the plants, microorganisms, and animals on this planet. Carl Linnaeus coined the taxonomy term. He is known as the father of taxonomy. Microbial taxonomy is a criterion of grouping microorganisms into groups based on their similarities and past relatedness. Microorganisms belonging to the same group are differentiated from the others via grouping into categories. This differentiation makes the study of microorganisms easy. There are different types of microbial taxonomies like Numerical and Molecular taxonomy. The study of microorganisms is known as microbiology. Microbiology is a broad term that takes into account microbial cultures, taxonomic studies, evolutionary relationships. Microbial interaction and diversity are huge data that needs to be compiled under the subject of microbiology. Microbiology covers various organisms like bacteria, fungi, algae, plants, animals, etc.

Question

For a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides from the 5' to the 3' end in the mRNA transcript?

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
If the genetic code used 4 bases at a time, how many amino acids could be encoded?
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand?
Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and direction of the mRNA strand synthesized from this DNA?
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary DNA strand?
If the mRNA sequence is 5'-UUU-CCC-AAA-3'.The DNA coding strand should be 5'-TTT-CCC-AAA-3' ?The DNA template strand should be 3'-AAA-GGG-TTT-5' ?So in the 5 to 3 direction, the DNA template strand should be 5'TTT-GGG-AAA-3' ?
In eukaryotic cells, the length of the transcribed RNA is almost equal to the corresponding DNA strand. True or false?
What is the sequence of the DNA template strand from which each of the following mRNA strands was synthesized? a. 5 '–UGGGGCAUU–3 ' c. 5 '–CCGACGAUG–3 'b. 5 '–GUACCU–3 ' d. 5 '–GUAGUCACG–3 '
If the base sequence on one DNA strand is ATGGCCTAG, what is the sequence on the other strand of the helix? If the original strand serves as the template for transcription, what is the sequence on the new formed RNA strand?
Within the template strand of the DNA in a gene, the sequence TAT is changed by mutation to TAC. Following replication of the DNA, what change in the polypeptide product would this cause?