Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 15RQ
A scientist identifies a pre-mRNA with the following structure.
What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5' cap and 3’ poly-A tail?
- 220bp
- 295bp
- 140bp
- 435bp
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Shown below is the sequence of the 5' end of a hypothetical mRNA. Where does translation of this mRNA begin? (the number of each nt is shown on top).
a. nucleotide 1
b. nucleotide 5
c. nucleotide 10
d. nucleotide 11
what does mature mRNA look like after processing? Include 5'cap, 5' UTR, +1 site, exons, 3' UTR, polyadenalation sequence, poly A tail.
A small section of bacterial mRNA has the following nucleotide sequence:GAC CCG AUG AACThe tRNA anticodons for the mRNA sequence shown above is
a.
CTG GGC TAC TTG
b.
CUG GGC UAC UUG
c.
GAC CCG ATG AAC
d.
CUG GGC TAC UUC
Chapter 15 Solutions
Biology 2e
Ch. 15 - Figure 15.11 A scientist splices a eukaryotic...Ch. 15 - Figure 15.13 Errors in splicing are implicated in...Ch. 15 - Figure 15.16 Many antibiotics inhibit bacterial...Ch. 15 - The AUC and AUA codons in mRNA both specify...Ch. 15 - How many nucleotides are in 12 mRNA codons? 12 24...Ch. 15 - Which event contradicts the central dogma of...Ch. 15 - Which subunit of the E. coli polymerase confers...Ch. 15 - The -10 and -35 regions of prokaryotic promoters...Ch. 15 - Three different bacteria species have the...Ch. 15 - Which feature of promoters can be found in both...
Ch. 15 - What transcripts will be most affected by low...Ch. 15 - How do enhancers and promoters differ? Enhancers...Ch. 15 - Which pre-mRNA processing step is important for...Ch. 15 - What processing step enhances the stability of...Ch. 15 - A scientist identifies a pre-mRNA with the...Ch. 15 - The RNA components of ribosomes are synthesized in...Ch. 15 - In any given species, there are at least how many...Ch. 15 - A scientist introduces a mutation that makes the...Ch. 15 - Imagine if there were 200 commonly occurring amino...Ch. 15 - Discuss how degeneracy of the genetic code makes...Ch. 15 - A scientist sequencing itiRNA identifies the...Ch. 15 - If mRNA is complementary to the DNA template...Ch. 15 - In your own words, describe the difference between...Ch. 15 - A fragment of bacterial DNA reads: 3’...Ch. 15 - A scientist observes that a cell has an RNA...Ch. 15 - Chronic lymphocytic leukemia patients often harbor...Ch. 15 - Transcribe and translate the following DNA...Ch. 15 - Explain how single nucleotide changes can have...Ch. 15 - A normal mRNA that reads 5’ -...
Additional Science Textbook Solutions
Find more solutions based on key concepts
A seagull flies at a velocity of 9.00 m/s straight into the wind. (a) If it takes the bird 20.0 min to travel 6...
College Physics
If an egg rolls out of the nest, a mother greylag goose will retrieve it by nudging it with her beak and head. ...
Campbell Biology (11th Edition)
CONCEPT QUESTION Review the Chapter Concepts list on p. 62. These all relate to exceptions to the inheritance p...
Concepts of Genetics (11th Edition)
Why is an endospore called a resting structure? Of what advantage is an endospore to a bacterial cell?
Microbiology: An Introduction
7. Which bones form via intramembranous ossification?
a. Irregular bones
b. Certain flat bones
c. Long bones
d....
Human Anatomy & Physiology
Name the components (including muscles) of the thoracic cage. List the contents of the thorax.
Human Physiology: An Integrated Approach (8th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the precedingarrow_forwardA certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).arrow_forwardWhich of the following is/are not found in a bacterial mRNA molecule? (a) stop codon (b) upstream leader sequences (c) downstream trailing sequences (d) start codon (e) promoter sequencesarrow_forward
- The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNAarrow_forwardCompare bacterial and eukaryotic mRNAs, and explain the functional significance of their structural differences.arrow_forwardEukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.arrow_forward
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:arrow_forwardAn unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bparrow_forwardThe following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Draw the primary transcript and the mRNA resulting from this DNA.arrow_forward
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?arrow_forwardIf the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. fivearrow_forwardAn mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning 
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY