A. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the parent DNA (3' to 5') strand correspond to a start codon and its last three nucleotides correspond to a stop codon in its MRNA counterpart later on.) Write it down as follows: a. the sequence of parent DNA (template) 3' A C A TT 5' 3' Upon undergoing DNA replication, show what one daughter DNA molecule will look like. Write it down as follows: b. the sequence of DNA Daughter 1: 3' 5' 5' 3' C. the sequence of DNA Daughter 2: 3' 3' 5' in in

A. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the parent DNA (3' to 5') strand correspond to a start codon and its last three nucleotides correspond to a stop codon in its MRNA counterpart later on.) Write it down as follows: a. the sequence of parent DNA (template) 3' A C A TT 5' 3' Upon undergoing DNA replication, show what one daughter DNA molecule will look like. Write it down as follows: b. the sequence of DNA Daughter 1: 3' 5' 5' 3' C. the sequence of DNA Daughter 2: 3' 3' 5' in in

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Similar questions

Explain the effect(s) the following scenarios would have on DNA replication or translation. For each scenario, state whether DNA replication or translation would be able to proceed and explain your reasoning. Low amount of 7- methyl guanosine in the nucleus low amount of DNA polymerase I lack of helicase
DNA Replication occurs on both prokaryotes and eukaryotes. Although they have a similar genetic flow, there are small differences in between. What are the differences of DNA replication in prokaryotes and eukaryotes? What is/are the major difference/s?
(a) What will be the problem during DNA replication if the enzyme primase becomes non-functional? (b) In which step of the central dogma is the genetic information of DNA copied into new DNA strands? (c) Which of the following codons is a start codon: GCU, AUG or UGA?
On paper, replicate the following segment of DNA: 5’ A T C G G C T A C G T T C A C 3’ 3’ T A G C C G A T G C A A G T G 5’a. Show the direction of replication of the new strands and explainwhat causes lagging and leading strands to show different patternsof replication.b. Explain how this is semiconservative replication. Are the newstrands identical to the original segment of DNA?
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
a) Explain how the molecular mechanism of DNA polymerase enhances DNA replication. b) Discuss the characteristic of DNA polymerase 1, Nick translation Proofreading
Describe the d=features of the following DNA-binding domains and how they interact with DNA. Helix-turn-Helix Zinc Finger Leucine Zipper Helix-loop-Helix
Indicate whether each of the following statementsrelating to aspects of DNA replication is true or false.a. The lagging strand grows in the same direction as thereplication fork moves.b. Growth of the leading strand involves the productionof Okazaki fragments.c. Lagging strands always involve “daughter” DNAsegments, and leading strands always involve“parent” DNA segments.d. The enzyme DNA ligase effects the unwinding of aDNA double helix.
Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?
he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′
Assume that the sequence of bases shown below is presenton onenucleotide chain of a DNA duplex and that the chain has openedup at a replication fork. Synthesis of an RNA primer occurs on thistemplate starting at the base that is underlined.(a) If the RNA primer consists of eight nucleotides, what is itsbase sequence?(b) In the intact RNA primer, which nucleotide has a free 3'-OHterminus?3'.......GGCTACCTGGATTCA....5'
DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’a. what is the non-template/sense/coding strand?b. What is the arrangement of the m-RNA?c. What's the chain arrangement of the amino acids that will be made according to the order of the RNA?d. If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed?e. What's the chain arrangement of the amino acids produced by this mutation?