Explain the effect(s) the following scenarios would have on DNA replication or translation. For each scenario, state whether DNA replication or translation would be able to proceed and explain your reasoning. Low amount of 7- methyl guanosine in the nucleus low amount of DNA polymerase I lack of helicase

Explain the effect(s) the following scenarios would have on DNA replication or translation. For each scenario, state whether DNA replication or translation would be able to proceed and explain your reasoning. Low amount of 7- methyl guanosine in the nucleus low amount of DNA polymerase I lack of helicase

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 22P

See similar textbooks

Similar questions

he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′
Briefly discuss the pros and cons of having a nucleoid (as bacteria do) versus a double nuclear membrane surrounding the DNA (as in eukaryotes). List and explain three reasons why DNA replication is very accurate.
The reaction in DNA replication catalyzed by DNA ligase isa) Addition of new nucleotides to the leading strandb) Addition of new nucleotide to the lagging strandc) Formation of a phosphodiester bond between the 3’-OH of one Okazaki fragment and the 5’-phosphate of the next on the lagging strandd) Base pairing of the template and the newly formed DNA strand
Explain the function of an origin of replication in the replication of DNA, and know how the prokaryotic and eukaryotic cells differ in terms of the number of origins of replication on each chromosome. Explain why replication is different on the two strand at a replication fork, including: how these differences are related to the fact that DNA strands are synthesized in a 5’ to 3’ direction. what is meant by the terms bidirectional replication, and replication bubble. the role of the leading strand, lagging strand, Okazaki fragments, continuous and discontinuous replication
Indicate whether each of the following statementsrelating to aspects of DNA replication is true or false.a. The lagging strand grows in the same direction as thereplication fork moves.b. Growth of the leading strand involves the productionof Okazaki fragments.c. Lagging strands always involve “daughter” DNAsegments, and leading strands always involve“parent” DNA segments.d. The enzyme DNA ligase effects the unwinding of aDNA double helix.
From standpoint of replication and transcription, explain how RNA polymerase is allowed to incorporate the first nucleotide whereas DNA polymerase needs a primer. Explain how this difference impacts the process of replication and transcription.
Replication of a circular DNA molecule can occur by either theta replication or by rolling circle replication. Describe or explain three differences between these two modes of DNA replication. Be VERY specific and accurately describe the differences between the two.
Shown below is a long template strand of DNA where lagging strand DNA synthesis is occurring. The short horizontal lines represent two Okazaki fragments that have already been made. In the context of the replication fork, select the letter(d–g) that indicates where primase will synthesize the next RNA primer. Explain why did you choose that location?
During DNA replication, 3 different proteins are used in the process to unwind and seperate the DNA. What are these 3 proteins and is there an helpful way that can I remember what each of thier functions are?
DNA replication is bidirectional and discontinuous. Explain your understanding of these concepts
With regard to DNA replication, define the term bidirectional replication.
Describe DNA replication. What are Okazaki fragments? Why does each chromosome have thousands of replication start sites instead of just one?