Calculate the DN/DS ratio for the sequences below. TTT ACT AAT AGT TTC CCT AAC GAT
Q: Calculate the melting temperature of this primer and estimate the annealing temperature of this…
A: Introduction PCR (polymerase Chain Reaction) is a molecular technique by which multiple copies of…
Q: Second Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original:…
A: So, the given information is:- ORIGINAL- AGAGAGAGAGAGAGAGAG…
Q: Write an accurate and precise differential report on the sanger sequencing technique
A: The sanger sequencing technique is also called chain-termination method which is made to determined…
Q: Which lab technique can you use to verify? a.Nucleic Acid Purification b. PCR c.SNP Variation
A: Any kind of verification in genetics is done by Ployerase chain reaction. Here a very small amount…
Q: How big (in base pairs) is (are) the fragments generated by digesting the vector with EcoRI
A: Base pairs - there are four bases or nucleotides in DNA: ADENINE, CYTOSINE, GUANINE, and thymine.
Q: Refer to the attached DNA model. In the spaces provided on the attached table, identify the…
A: DNA or deoxyribonucleic acid is the genetic material present in most organisms. It is composed of…
Q: Which of these is not a tool for comparing DNA sequences? PLINK Fasta BLAST A dotplot e.g. dotlet
A: DNA polymerase is an enzyme. A primer is a single-stranded DNA fragment that binds to template DNA…
Q: make a diagram or schematic representation of Restriction fragment length polymorphism or RFLP
A: Genetics is a part of science worried about the investigation of genes, genetic variety, and…
Q: From your knowledge about DNA microarray, answer the following: Mention the name and the color of…
A: DNA microarray is basically a collection of microscopic DNA spots that are attached to the solid…
Q: In the "Indexing DNA" method of n k-mer table, the maximum number of compares when the k-mers are…
A: Indexing of genome is done in order to index all the small sequenes within the large genome.The…
Q: Why is it helpful to use a computer program to translatea genetic sequence rather than doing it by…
A: the benefits are:
Q: Mapping is the bioinformatics term used to describe alignment of sequence reads to a reference…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: Cmet-leu-phe-arg-glu-glu lou-ser-tou E)met-arg-glu-arg-glu-arg 231frecall) Agarose gel…
A: DNA, or deoxyribonucleic acid, is a molecule that holds the biological instructions that distinguish…
Q: The gel pattern below was produced by the Sanger sequencing method. Determine the sequence…
A: In sanger Sequencing, the products of the nucleotides A, G, C, and T reactions are individually…
Q: During a typical gel electrophoresis set up (negative pole at the top), which DNA fragment would be…
A: Gel electrophoresis is the technique for the separation of DNA fragments on the basis of size and…
Q: The sequence below (A) was read from the autoradiogram (B). (A) 5'…
A: Note: since you have asked multiple unrelated questions, as per the honor code we are answering the…
Q: Why are the first 20 bases typically ignored from a Sanger sequencing .ab1 file? The data quality is…
A: The data quality is too low and the data is noisy
Q: Describe the Amplified Fragment Length Polymorphisr (AFLP) method. Give the advantages and…
A: AFLP is a technique used to detect polymorphisms in DNA when no information about the genome is…
Q: What does BLAST stand for? Basic Local Alignment Search Tool Basic Local Alignment SequenceToo Best…
A: The best option is (a) Basic Local Alignment Search Tool.
Q: 3000 bp 2000 bp 1000 bp 800 bp 700 bp 500 bp L Uncut EcoRI 1 BamHI Ncol EcoR1/BamH1 BamHI/Nco1…
A: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…
Q: Based on the restriction enzyme specificities given below, what was the enzyme utilized to produce…
A: The corner stone of genetic engineering or recombinant DNA technology is a special class of enzymes…
Q: Suggest and describe two methods to detect DNA concentration by using in text citation and provide…
A: DNA is genetic material in almost all living organism that transit from one generation to another
Q: CDNA libraries Select an answer and submit. For keyboard navigation, use the select an answer. a a)…
A: Gene is the primary fundamental unit. These are made up of Deoxyribonucleic acid (DNA). The DNAs…
Q: Use the sequence alignment tool Smith and Waterman for the amino acid number 16-30 of the protein…
A: The Smith-Waterman algorithm uses local sequence alignment to find similar regions between two…
Q: A DNA sample was sent off for Sanger sequencing. The results are shown below. What is the sequence…
A: The Sanger sequencing is also known as the chain termination method, it is a method used to…
Q: Below is a set of sequence reads from an individual aligned to a reference sequence. AGACACTCCACC…
A: Homozygous SNPs - has multiple possible alleles - 1 Heterozygous SNPs - has specific insertions or…
Q: Shine-Delgarno sequence polyribosome formation operator Two of the above are correct
A: Shine Dalgarno sequence present at the 5 ends of the mRNA preceding the start codon of mRNA. It…
Q: Please check the pic. Find out where the divisions between fragments are , the number of fragments…
A: An important enzyme is EcoRI, plays an important role in recombinant DNA technology. These enzyme…
Q: ns: In each box, type the hrst letter of the base that correctly matches the given DNA sequences C…
A: Answer. A nucleotide is the monomeric unit of nucleic acids. Nucleic acids are therefore also called…
Q: What is a? 3' 5' a b. 5' d 3' e f a 5' 3' .3' 5' Select an answer and submit. For keyboard…
A: Answer : Option (a) template strand is right answer. a is template strand.
Q: Identify the dinucleotide CA repeat region and the score in the following sequence:…
A: Nucleotide is defined as the basic block of DNA and RNA that also known as building block of it.
Q: Which of the DNA sequences shown below can be cut by using restriction enzyme' Explain your answer…
A:
Q: Write the sequences of the two 12-residue primers that could be used to amplify the following DNA…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Based on the restriction enzyme specificities given below, what was the enzyme utilized to produce…
A: A restriction enzyme, also known as a restriction endonuclease, is a bacterial protein that cleaves…
Q: Define the following terms:a. PCRb. DNA microarrayc. chromosomal jumpingd. genome projecte.…
A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…
Q: Which of these is not a tool for comparing DNA sequences? O PLINK O A dotplot e.g. dotlet O Fasta O…
A: There are different tools in bioinformatics that help in sequencing and comparing the DNA sequences.…
Q: State the function of each chemical/components below in DNA extraction Salt: Detergent:…
A: Breaking cells open to release the DNA. Separating DNA from proteins and other cellular debris.…
Q: Which lane shows the DNA fragment completely digested with Pst n
A: Restriction endonuclease are the enzymes which cleave the DNA at specific sites Various sites are…
Q: 2: Align DNA sequences using dot matrix Horizontal sequence: AGGCTCCC; vertical sequence: GCGCTCCG.…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Describe the process for shotgun sequencing of a genome. Practice aligning the two sets of sequenced…
A: Two questions have been asked. first question has been answered. To get the answer for your second…
Q: On the image below what is the next nucleotide to be added on the oldest Okazaki fragment (use…
A: Answer- The next nucleotide to be added on the oldest Okazaki fragment will be in the direction 5'…
Q: From a single DNA molecule, calculate how many copies would be produced in 12 cycles of pcr
A: PCR(Polymerase Chain Reaction) is defined as a type of amplification technique where it amplifies…
Q: During a typical gel electrophoresis set up (negative pole at the top), which DNA fragment would be…
A: The answer is 100 kb .
Q: Examine the table of recognition sites for restriction enzymes below. Cutting with which two…
A: Restriction endonucleases are specific enzymes that recognize a specific DNA sequence (restriction…
Q: On the gel diagram below, show how you believe these fragments will sort out during electrophoresis.…
A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Perform Progressive Alignment Method on the following 5 sequences and findthe best multiple sequence alignments.Sequence # 1: ATCCAATTTTSequence # 2: ACTGACCSequence # 3: ATGGCCATTSequence # 4: ATCTTCTTSequence # 5: ATTGCCATTWrite down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTTHere is a nucleotide sequence: ATGCAAGGTT. Choose the answer that correctly identifies both the type of nucleic acid that this sequence represents and the complementary DNA sequence Select one: a. DNA; TACGTTCCAA b. RNA; TACGTTCCAA c. RNA; AACCTTGCAT d. DNA; AACCTTGCAT
- Identify whether the base sequences represent only a DNA sequence, only an RNA sequence, or either a DNA or RNA sequence. 1.TACATAC 2.GAUCACG 3.3.4 INSTRUCTIONS — Do not copy in Google or Bartleby. Plagarize Checker will be usedWrite an accurate and precise differential report on the sanger sequencing technique
- Write the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACATElectrophoresis separates fragments of DNA according to_____ . a. sequence b. length c. speciesChoose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
- Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAAEstimate the fragment sizes (bp) of the DNA bands from each sample laneGiven the electrophoresis profile of a Sanger sequencing result, what was the sequence of the original DNA sample used for sequencing? GGTAACC CCAATGG GGTTACC CCATTGG