On the image below what is the next nucleotide to be added on the oldest Okazaki fragment (use picture)? A C G T

Q: G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g…

A: Dna is read in 5 ' to 3 ' direction and the mrna is read by the trna in the form of genetic code by…

Q: Complete the attached table representing structural characteristics of A, B and Z DNA duplex. A form…

A: DNA can exist in several forms .There are three major forms of DNA are A-DNA, B-DNA and Z-DNA. The…

Q: Refer to the attached DNA model.  In the spaces provided on the attached table, identify the…

A: DNA or deoxyribonucleic acid is the genetic material present in most organisms. It is composed of…

Q: Draw the full structure of the DNA dinucleotide C-T. Identify the 5′ and 3′ ends of this…

A: Deoxyribonucleic (DNA) acid is a double helix structure, which is composed of nucleotides joined by…

Q: BOTTOM The sequence depicted on the gel is 5'-GTGATGTAG-3' The sequence depicted on the gel is 3'-…

A: This method is used for DNA sequencing and it relies on the use of Deoxyribonucleoside…

Q: The DNA sequence you use will be the following:  T - A - G - C - C - A.  You will need to make the…

A: chargaff's rule states that in DNA sequence in  complementary strands the Adenine will form a bond…

Q: A linear piece of DNA was broken into random, overlapping fragments and each was sequenced. The…

A: Introduction DNA is an organic chemical that contains genetic information as well as instructions…

Q: An inappropriate base change that has no discernible effect is called a _____________ mutation.

A: The mutation is the process, which helps to change the bases in the DNA segment and exert different…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: Identify the following nucleotide: ball & stick v labels Name:

A: Bothribonucleic acid (RNA) and deoxyribonucleic acid (DNA) are composed of nucleotides. A nucleotide…

Q: Sequencing of the following fragment of single-stranded DNA needs to be undertaken using the Sanger…

A: Sanger sequencing, also referred to as the “chain termination method”, may be a method for…

Q: Choose the correct protein sequence that would result from the following DNA template sequence using…

A: Central dogma is the central cellular process that helps in the conversion of the DNA to m RNA by…

Q: Label the 5'  and 3' end of each nucleotide and approximate where the start point (+1) would be on…

A: The process shown here is called transcription.  In this process a molecule of mRNA is synthesized…

Q: Which of the following are possible base compositions for double stranded DNA? O A=30% G=20% C=20%…

A: DNA is composed of nucleotides which are composed of nitrogenous bases, a pentose sugar, and…

Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…

A: Mutation is defined as the change in the nucleotide sequence of DNA.

Q: Please help me make an abstract using the information below it is the result and discussion of the…

A: DNA i.e. Deoxyribose nucleotide : It consists of nitrogen bases i.e. Adenine , Guanine , Cytosine…

Q: If you have a given amino acid, can you be able to identify its RNA? Why or why not?

A: The protein is made up of amino acids and it is the final product of a gene. It determine the…

Q: Why is it that there is more distortion in a protein when it's not attached to a DNA strand? In…

A: Protein-DNA interactions are important for all biological systems to function properly and form the…

Q: Write a DNA structure having 8 nucleotides.

A: Deoxyribose Nucleic Acid is double stranded polymer of purines and pyrimidines. As per Chargaff's…

Q: Please by using the first base of each as the first triplet in a condo, how do I translate two…

A: Translation Translation is the process in which the mRNA or messenger RNA is get translated. mRNA of…

Q: By convention, nucleotide sequences are always written from the _____.

A:

Q: Given the choices, a. 25 b. 18 c. 23 d. 21 how many hydrogen bonds are present in a DNA double…

A: DNA is also known as deoxyribonucleic acid. DNA acts as genetic material in most of the organisms…

Q: Which of the following conventions is used to specify the sequence of bases in DNA a) The sequence…

A: A deoxyribonucleotide of DNA is formed by crosslinking orthophosphoric acid, deoxyribose sugar and a…

Q: suppose there are three tubes containing DNA RNA and protein samples in THE laboratory. the three…

A: Introduction: Those biomolecules that require in large amount to keep the body fit and healthy are…

Q: Cause Would result in the following error Unbalanced nucleotide concentrations a) Sequence errors in…

A: The polymerase chain reaction is the method that is used for making copies of DNA, it is developed…

Q: For the DNA structure below write the correct base sequence in the form: 5-АТСТ-3 3'-TAGA-5 Make…

A: DNA or deoxyribonucleotide is the genetic material that is present in the higher organisms like…

Q: Given Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ PLEASE PROVIDE THE RANSLATION OF THE FOLLOWING:…

A: The template strand is from 3` 5` and a coding strand of DNA is from 5` to 3`. The synthesis of m…

Q: A DNA sample contains 21% adenine. What is its completepercentage base composition?

A: DNA is the deoxyribonucleic acid which is a double-stranded helical structure found in the nucleus…

Q: You analyse some DNA using an automated sequence reaction. The first peak you observe is labeled…

A: Given: You analyse some DNA using an automated seqyence reaction. The first peak you observe is…

Q: Using this strand of DNA (TACAACTGA), show what a substitution would look like”

A: Substitution is a type of genetic mutation in which there are three possibilities after the…

Q: Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’…

A: Nucleus is main controller of the cell which carries genetic instructions . It contain Chromosome…

Q: Give the sequence of unpaired bases that would be sticky with the following sequences:(a) GGTAC (b)…

A: Restriction endonucleases may cut DNA. The ends of the DNA may be blunt or sticky. A straight cut…

Q: ns: In each box, type the hrst letter of the base that correctly matches the given DNA sequences C…

A: Answer. A nucleotide is the monomeric unit of nucleic acids. Nucleic acids are therefore also called…

Q: From the following DNA template, which sequence is synthesized by RNA Polymerase?    5’- T  – C – C…

A: According to the central dogma of molecular biology, the information stored in DNA is first…

Q: Put the following in order from smallest to largest. base [ Choose ] nucleotide [ Choose ] gene […

A: DNA is the unit of heredity. it is concentrated in the nucleus and it is responsible for…

Q: Give me an example of nucleotide sequence with

A: According to Chargaffs rules of base pairing or nucleotide pairing are: A with T: the purine adenine…

Q: Below is the sequence of a single strand of a short DNAmolecule. On a piece of paper, rewrite this…

A: Cells are the most fundamental and essential unit of life in all living things. All of life's…

Q: Write the base sequence that would be sticky with the sequence T-A-T-G-A-C-T.

A: Erwin Chargaff discovered the complementary base pair rule. according to the chargeoff base-pairing…

Q: Fill in the missing bases below to show the correct complementary base pairing. 5' 3'

A: In molecular biology Complementary base pairing or complementarity is a relation between two…

Q: The Sanger products in the sequencing of a template DNA is shown below: +ddTTP +ddATP +ddCTP +ddGTP…

A: Sanger method of DNA sequencing is a chain termination method of DNA sequencing in which…

Q: A base change that has no discernible effect is called a____________________ mutation.

A: Mutation- A sudden, heritable change the base sequences of the organism's genome that leads to…

Q: Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle…

A: DNA molecule is a polymer of nucleotides and each nucleotide has three main components that are…

Q: The bases are linked to theposition of the 5 carbon sugar in a nucleotide Select an answer and…

A: A nitrogen base, sugar molecule, and phosphate groups make a nucleotide. A nucleotide is a…

Q: In complementary base pairing which of the following base parings is incorrect? a. G-C b. G-T OC.…

A: ANSWER'- b) G-T  Explain;-G-T is incorrect pair. Base pairing happens between a purine and…

Q: Enumerate all the possible DNA nucleotide base sequence for the amino acids given.

A: To synthesize protein molecules, a cell must first transfer information from DNA to mRNA through the…

Q: E. coli incorporates deoxyribonucleotides into DNA at a rate of 250 to 1000 bases per second. Using…

A: DNA replication is the process of synthesis of two double-stranded DNA from the original…

Q: Using Chargaff’s rule of base pairing determine the amount of guanine in 120 bp long fragment of…

A: According to Chargaff's rules, DNA from every species of any organism should have a 1:1…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: If your lab partner sent your sequence to the printer and the sequence said: A 37%, U 37%, C 13%.…

A: Deoxyribonucleic acid (DNA) is the main constituent of the chromosome. It contains all information…

Q: On the gel diagram below, show how you believe these fragments will sort out during electrophoresis.…

A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.