True or False.  In a comparison between the DNAs of related organisms such as humans and mice, conserved sequences represent functionally important exons and regulatory regions, and non-conserved sequences generally represent noncoding DNA. Explain your answer in 2-3 sentences.

Q: Composition as a mole fraction of one of a double-stranded DNA strand T = 0.22 and C = 0.30. In the…

A: Nucleic acids are the units of DNA or gene or chromosome. Genetic variation occurs due to…

Q: The inability of DNA polymerase to replicate the ends of linear chromosome in one strand, compare…

A: Introduction  The biological process of producing two identical copies of DNA from a single original…

Q: In bacteria, the ___consensus sequence of mRNA binds to the ____rRNA of the 30S small subunit during…

A: * Translation is the process in which genetic code is present in a messenger RNA molecule is decoded…

Q: How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one…

A: Restriction endonuclease is defined as an enzyme responsible for cleaving DNA into small fragments…

Q: Tick ​​the correct statements:   Remember: Tautomers are structural isomers that differ from each…

A: Ans). The first statement, the third statement, and the fourth statement are correct. Explanation:…

Q: The DNA of a skin sell and a muscle cell are identical. But the skin cell may contain the proteins…

A: DNA (Deoxyribonucleic acid) is a double helical structure present in nucleus of a cell and contains…

Q: When completing genome sequences, contiguous sequences, or contigs are important intermediates.…

A: * A contig refers to series of overlapping DNA sequences  that are used to make  physical map which…

Q: Select TRUE or FALSE for each of the following statements: 1. Only one of the three phosphate groups…

A: Human body is composed of different biomolecules that includes nucleic acids (DNA and RNA) proteins,…

Q: Suggest a reason why the proofreading step in protein synthesis takes place at the level of amino…

A: Proofreading refers to a mechanism for correcting errors in the translation process. It helps to…

Q: TRUE OR FALSE] 11. The structure of the DNA, being super coiled, promotes increased viscosity of…

A: Nucleic acid was first discovered by Friedrich Miescher from the nuclei of the pus cells…

Q: When large genomes are sequenced, which of the following is true? Group of answer choices   The…

A: Genome is defined as the total complete set of an organism's DNA where it contains of all the…

Q: 32. Would you expect to find hydrophobic amino acids on the external surface or internally in…

A: We are authorized to answer one question at a time since you have not mentioned which question…

Q: Q. 693 kbps is equals to how many Bps?

A: bps means base pairs. bps also represent bits per second. Base pairs are present in DNA and RNA…

Q: Suggest a reasonable strategy for the specific phosphorylation of the 5’ –OH group of a nucleoside.

A: Nucleosides are glycosylamines. They are basically nucleotides devoid of a phosphate group. It…

Q: Huntington's disease in regards to Trinucleotide repeats  give detailed reponses  provide exmaples

A: Huntington's disease(HD) is caused due to mutation in the HD gene where the trinucleotide…

Q: Steroids, carbohydrates, and phospholipidsare encoded by different types of genes thanare proteins.

A: The cells of all organism contain a genetic material that attributes to the uniqueness of an…

Q: stranded helix by doubling back. Draw the detailed chemical structures for all the base- pairing…

A: Triple helix The triple-stranded DNA is also called the H-DNA, it is called so because three…

Q: Human Genome Project In 2003, the Human Genome Project was successfully completed, determining the…

A: Patency can be defined as the term used for the proper authorisation or consent of a particular…

Q: Question text A DNA sense strand contains the following nucleotide base sequence: TAC AGC AAT CAC…

A: Transcription is defined as the process of creating an RNA copy of a gene sequence from a DNA…

Q: Q - Can you write one sequence of 15 nucleotides that can be produced using this transformational…

A: In this question, we need to find one sequence of 15 nucleotides from the given transformational…

Q: 4a in context to taking genomic DNA from eukaryotic cells and randomly shearing it into pieces of a…

A: Renaturation is a process of reformation of hydrogen bonds between the complementary single strands…

Q: True or False? Chromatin remodeling involves addition or removal of chemical groups to histones,…

A: The dynamic change of chromatin architecture to give condensed genomic DNA access to regulatory…

Q: TRNAS do vary in length. True False

A: RNA is ribonucleic acid which is formed from DNA .It is further of three types :- A )rRNA (…

Q: True or False? 454 platform sequencing involves attaching single -stranded DNA fragments to beads,…

A: 454 platform sequencing This technology is a high throughput sequencing method which is based on…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3'  From above sequence…

Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser…

A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and…

Q: TRUE OR FALSE: tRNA-met complexes with mRNA at the aminoacyl-site of the ribosome

A: Introduction  The process of decoding the genetic code contained within a messenger RNA (mRNA)…

Q: The double helix structure of deoxyribonucleic acid (DNA)

A: The characteristic features of an individual is controlled by the genes in DNA. The arrangement of…

Q: A lot of time and energy put into creating tRNAs; why?

A: A transfer RNA  is a kind of RNA molecule that helps to match an mRNA codon with the amino acid it…

Q: True/false? if false, justify briefly   The bacterial nucleoid comprises linear nucleic acid…

A: The genetic material of the cells is contained in the DNA which has the blueprint for the synthesis…

Q: Description about nucleosome what general type of interaction is(are) largely responsible for the…

A: The genetic material is made up of DNA and RNA. The DNA is negatively charged nucleic acids which…

Q: Good hand written explanation Asap Briefly describe the 2-dimensional and 3-dimensional structure…

A: Introduction  tRNA or transfer RNA is a type of RNA molecule. It plays an important role  in…

Q: Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of…

A: mRNAs are used to form protein by translation. The translation is performed using ribosomes, t-RNA…

Q: 1. Heterochromatin is typically gene-rich and composed of loosely-packed DNA that is…

A: “Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: What length of DNA (based on the number of subunits) has a potential diversity close to 3 *10^16?

A: The length of the DNA is determined by corresponding to the base pairs in the DNA and the distance…

Q: likely be able to bind a Cyclic AMP DNA binding protein? (only one strand is shown but assume DNA is…

A: CRP is a transcription factor that, when complexed with cAMP, binds DNA and activates transcription…

Q: replication, resulting in a (e) Errors may change to the sequence of base triplets. Explain how a…

A: Ans- Errors that arise during the DNA replication because of the change in sequence of gene triplets…

Q: Determine the exact molecular weight of the following oligonucleotide and calculate the average…

A: Oligonucleotides are short sequences of RNA or DNA, which are oligomers. These short sequences are…

Q: Calculating human genome If 1.5 percent of the human genome consists of protein-coding sequences,…

A: All humans have deoxyribonucleic acid (DNA) as constituent genetic material. This biochemical…

Q: Variable number tandem repeats (VNTRs) are repeating DNA sequences of about 15–100 bp in length,…

A: Forensic science. Criminological science is the use of science to criminal and common laws,…

Q: Explain why similarities between protein sequences (orbetween DNA sequences) can be used as a…

A: Sequence homology is the homology between DNA, RNA, or protein sequences that can determine the…

Q: Calculating Transformation Efficiency

A: Transformation is the process in which bacteria take up the foreign DNA/genetic material and such…

Q: binds to proteins called histones. Based on your knowledge of DNA (negative charges along the…

A: Histones are composed of mostly positively amino acid residues. The positive charges allow them to…

Q: The polyamines spermine and spermidine have numerous effects on both prokaryotic and eukaryotic…

A: Polyamine is a compound which has more than two amino groups.

Q: DNA Structure Provide a detailed (hand-drawn) structure of the double-stranded DNA GGATCC

A: DNA is a nucleic acid. DNA is polymer of nucleotides. Nucleotide is composed of pentose sugar,…

Q: Protein sequences which are usually more advantageous than DNA sequence in the comparative pairwise…

A: The term pairwise sequence alignment refers to the process of lining up of two sequences to get the…

Q: He follówing diagram of how protein AWESOME1 binds to it's target DNA, al effects of each of the 5…

A: A mutation is a permanent change in the nucleotide sequence of DNA that can occur during replication…

Q: Central Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying…

A: Central dogma means the flow of information occurs from DNA to RNA, and RNA to proteins. Proteins…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.