Question
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC
 
1. Identify the gene from which the querysequence originates (Name of gene)
2. Provide the FULLprotein sequence encoded by the gene.
3. Are different splice variants known for this gene?
4. What human disease has been connected to this gene?
5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
 

Expert Answer

Want to see the step-by-step answer?

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.
Tagged in
Science
Biology

Biotechnology

Related Biology Q&A

Find answers to questions asked by students like you.

Q: Which of the following mutations involve the loss of one or more nucleotides from a gene sequence?  ...

A: Mutation is the change or alterations in the nucleotide sequence of genome of an organism. Mutation ...

Q: A bacterium is infected with an experimentally constructedbacteriophage composed of the T2 phage pro...

A: Bacteriophages are a group of viruses which has the capacity to infects bacteria. Bacteriophages are...

Q: What are the five major unranked taxa above the phylum level in animal taxonomy?

A: The taxonomic ranks which are defined by the International Code of Zoological Nomencalture, are the ...

Q: Describe the differences you observed in the type and distribution of hair on the front (anterior) a...

A: In human anatomy, the arm is the part of the upper limb between the shoulder joint and the elbow joi...

Q: What is the principle component of dietary fiber?

A: Dietary fibres are the edible parts of a plant or they are analogous carbohydrates that are resistan...

Q: A mouse sperm of genotype a B C D E fertilizes an egg of genotype a b c D e. What are all the possib...

A: A gene is the basic functional and physical unit of inheritance. Genes are composed segments of DNA....

Q: How is cancer different from most other types of genetic diseases?

A: Cancer is the abnormal growth and multiplication of normal cells. Cancer cell divide rapidly. Cancer...

Q: Discuss why heritability is an important phenomenon in agriculture.

A: The term heritability refers to the amount of phenotypic variation within a group of individuals tha...

Q: "óu tell me briefly what caused the "bubbles" in the bread dough? We talked about it in the context ...

A:   It should be understood that Metabolism of sourdough microbiota and the activity of cereal enzymes...

Q: In the early 1900s, Lucien Cuénot studied the genetic basis of yellow coat color in mice (). He carr...

A: Genetics is the branch of biology that deals with the study of genome of an organism and its gene ex...

Q: Why is the orientation of muscle in the stomach wall important and how does it contribute to it’s fu...

A: The stomach walls contain three layers of smooth muscle arranged in longitudinal, circular, and obli...

Q: . Distinguish the terms grade and clade

A: Taxonomy is the branch of biology, which deals with the science of naming, defining and classifying ...

Q: Although it is well known that X-rays cause mutations, they are routinely used to diagnose medical p...

A: In the United States, radiation absorbed dose, effective dose, and exposure are sometimes measured a...

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name o...

A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one...

Q: 22. Polymerization of nucleotides results in: a) polypeptides b) polynucleotides c) polysacchar...

A: BASIC INFORMATION  POLYMERISATION It is the process in which  many small molecules combine with each...

Q: Please complete question 3 and 4

A: A dihybrid cross describes a mating experiment between two organisms that are identically hybrid for...

Q: Describe the mechanism of each of the following with respect to spiders: feeding, excretion, sensory...

A: Spiders belong to the class Arthropoda. Spiders can bite with their fangs which inject venom to kill...

Q: A scientist is studying the catabolism of glucose in a particular strain of bacteria. Normally, that...

A: Cellular respiration involved in catabolic reactions where larger molecules break down into smaller ...

Q: Biology Question

A: The esophagus transports food from the oral cavity to the stomach. It is lined by a stratified squam...