Q: ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’…
A: RNA is formed from DNA by the process of transcription. Amino acids are formed from RNA by the…
Q: what reaction activates the amino acids for attachment to the appropriate tRNA before being…
A: Translation is the process of synthesis of proteins from mRNA. It is completed in three steps -…
Q: As part of a project investigating potential new drug targets in the fight against malaria, you are…
A: Introduction:- Truncation of protein:- is meant by the proteolysis or structural gene manipulation…
Q: RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA, This strand…
A: Transcription is the process of transforming the information of DNA sequences in to the mRNA strand.
Q: Does crude mRNA have density? if so what is the density value ? Thank You
A: Introduction mRNA is single stranded RNA. Which carries genetic information from DNA to ribosomes…
Q: Apeptide was sequenced and the sequence of fragment sets generated by different cleavage methods is…
A: Amino acids are the molecules that join to form a protein structure. The bond formed between two…
Q: Question:- Can you please explain the general rule on how to manually align these sequence?? i am…
A: DNA sequencing is a technique for determining the exact sequence of bases (A, C, G, and T) in a DNA…
Q: Direction: On the worksheet, all the DNA sequences run from 3' to 5'. Supply the corresponding amino…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: With regards to this sequence below please answer this quistions 1) What is the format of the…
A: answer given below
Q: Transcriplioh nie For cuch of the following sequences, fill in either the DNA, the mRNA sequence,…
A: Synthesis of m RNA Sandhya and RNA transcription and synthesis of amino acids linked together by…
Q: Sequence: CUCAACACGCCGCUCAGUGCCCUCGUGAUGAAGCAUAGGGGAAAC By in vitro translating the mRNA, you…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…
A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…
Q: CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5
A: Genetic codes are read in the form of triplets.first we will convert them to the triplets and then…
Q: 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries…
A: 5) To calculate molecular weight (KiloDalton [kD]) and the calculated pI of the protein, submit the…
Q: Consider the λ bacteriophage DNA molecule as shown in Figure 21.14. Total digestion with the two…
A: DNA or deoxyribonucleic acid is a type of biomolecule. It is a polymer of deoxyribonucleotides…
Q: RNA sequence of A gene If we have the following mutations, find the type of the mutation…
A:
Q: m
A: DNA → RNA RNA → protein
Q: Answer the following parts: A. When performing classical Sanger or "dideoxy" sequencing, you set up…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: sequence belo - Indicate the start site for translation by underlining the start codon. - Translate…
A: mRNA sequence 5' GUAGUCAUGCCCGACGCAUUUACGAUUCAGUGACUG 3'. The codons are triplet in nature and the…
Q: V. Materials. To be procured by each student: Genetic code VI. Procedure 1. Assume that a segment of…
A: DNA strand "A" = 5' TTCTTGTCATACTGCTGGCTGCCCCACCAGCGAATGGTGACAAACAAG 3' Note:-i answer according to…
Q: Obtain the self-dotplot of the following sequence to identify repeat region:…
A: There are various alignment tools available at EMBOSS. It is studied under the domain of…
Q: 8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…
A: Mutation can be defined as change in nucleotide sequence of a gene. Based on the type of change,…
Q: Answer codon usage based on this description: You have isolated a new eukaryotic microorganism and…
A: Codons It refers to the sequence of three consecutive nucleotides that are present in the DNA or RNA…
Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…
A: The process of gene expression involves the process of transcription followed by the process of…
Q: Gene editing is also used to explore the structure and function ofproteins. For example, changes can…
A: From the observations, it gets clear that the amino acid aspartate shows the most functional…
Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 5. Calculate molecular weight (kiloDalton, kD) and calculated pI…
A: Hi! Thanks for your question. As you have posted multiple questions, we are answering the first two…
Q: that the
A: Polypeptides, or proteins, are chemical compounds composed up of amino acids. They're big,…
Q: MRNA 20 ORI 40 - FTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGHAATATOGGGATGCACTATC…
A: Gene expression includes transcription and translation. It leads to synthesize mRNA and protein…
Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…
A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3' From above sequence…
Q: I keep getting this maked wrong, if you distinguish my mistake and explain to me in a deeper…
A: The translation is the process by which the genetic code encrypted in the mRNA gets converted to…
Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…
A: Mutation is in 3rd codon from 3' end. In wild type it codes for histidine while in mutant it codes…
Q: Kindly help, I don't understand this topic :(( In each of the following DNA sequences, write the…
A: Introduction :- The genetic code is a set of laws that define how DNA's four-letter code is…
Q: 5' AGGGUUUGGGAUGAAUCGACGACGAUCCUACGUACUAAGUA 3' Write the amino acid sequence for this portion of…
A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…
Q: 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you…
A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…
Q: Let's Apply In each of the following DNA sequences, write on your answer sheet the corresponding…
A: DNA ( Deoxyribonucleic acid ) is two stranded helical structure which act as genetic material in…
Q: Please answer fast Determine the amino acid sequences for the six open reading frames for this 9…
A: An amino acid is one of the structural blocks of a protein. A gene's DNA grouping decides the order…
Q: Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of…
A: mRNAs are used to form protein by translation. The translation is performed using ribosomes, t-RNA…
Q: 30 A DNA sequence encoding a five-amino acid polypeptide is given below.…
A: The process of translating an mRNA strand into an amino acid sequence at the time of protein…
Q: Assume that the translational error frequency, 8, is 1 × 10-4. (a) Calculate the probability of…
A: The translation is the process of making a polypeptide chain from mRNA. The translation is catalyzed…
Q: 6a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…
A: DNA (deoxyribonucleic acid) often experience changes as a result of replication errors or…
Q: Calculating human genome If 1.5 percent of the human genome consists of protein-coding sequences,…
A: All humans have deoxyribonucleic acid (DNA) as constituent genetic material. This biochemical…
Q: 4. What human disease has been connected to this gene?
A: Hello. Since your question has multiple parts, we will solve first question for you from which you…
Q: TTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: Please solve and answer in complete sentences. (thank you) Sequence divergence vs conservation for…
A: The exons are the type of sequences that are utilized after the processing of the mRNA is complete.…
Q: Low-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence…
A: Fibroins are insoluble proteins that are present in silk produced by insects, such as the larvae of…
Q: 3b) In the real world, where "wobble" pairing is possible, what is the minimum number of tRNAs…
A: The process of formation of mRNA(messenger ribonucleic acid) molecules on the DNA(deoxyribonucleic…
Q: A protein has the following amino acid sequence:…
A: Amino acids- Amino acids are organic compounds that combine to form proteins. Amino acids and…
Q: 3. After aligning four protein sequences, following matrix was derived. Sequence Name the Seq-1…
A: DNA and RNA are the nucleic acids found in all living organisms. DNA and RNA are made up of…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Provide the FULL protein sequence encoded by the gene. Are different splice variants known for this gene?GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…Sequence: CUCAACACGCCGCUCAGUGCCCUCGUGAUGAAGCAUAGGGGAAAC By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
- Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC What human disease has been connected to this gene? Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?Please answer only questions 5-10, thank you GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; Journal Name; Volume; Page Numbers) for a recent publication involving the identified gene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebrate homolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL…
- Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?Question:- Can you please explain the general rule on how to manually align these sequence?? i am very confused when you have to use a dash '-'. I have never been taught how to sequence so this to me is new and confusing i dont know what i am doing. any advice/tips would be great. please explain step by step as to why you added the dash so i can understand and learn. thank you so much Align the following sequences Sequence A: CUCGAGUUAACCCGGCACCCG Sequence B: GCUCGGGUUAACACGGACCCG Sequence C: UCGAGCCAACUCGGACCCGPlease answer all questions GTTTTCACTGGCGAGCGTCATCTTCCTACT 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; Journal Name; Volume; Page Numbers) for a recent publication involving the identified gene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebrate homolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the identified putative protein products with at least one similar invertebrate protein (if there is none, use a vertebrate homolog).10. Generate a secondary structure prediction for one identified protein.
- Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.Codon-Anticodon Recognition: Base-Pairing Possibilities (Integrates with Chapter 11.) Draw base-pair structures for (a) a G:C base pair. (b) a C:G base pair. (C) a G:U base pair, and (d) a U:G base pair. Note how these various base pairs differ in the potential hydrogen-bonding patterns they present within the major groove and minor groove of a double-helical nucleic acid.