Can you please check my answer and make sure it is correct? Question: Why are hydrogen bonds so vital to the structure of DNA? Hydrogen bonds are important for DNA because they are the bonds between the bases and help DNA form into its double-stranded shape. These bases include adenine, thymine, guanine, and cytosine. Adenine forms two hydrogen bonds with thymine and guanine forms three hydrogen bonds with cytosine. The resulting double-strands are held together by hydrogen bonds which is an important characteristic for DNA. These weak bonds are stable, but can be separated when it is necessary. This process is necessary during DNA replication, when a duplicate copy of DNA is being made or during the denaturation step in PCR.

Can you please check my answer and make sure it is correct? Question: Why are hydrogen bonds so vital to the structure of DNA? Hydrogen bonds are important for DNA because they are the bonds between the bases and help DNA form into its double-stranded shape. These bases include adenine, thymine, guanine, and cytosine. Adenine forms two hydrogen bonds with thymine and guanine forms three hydrogen bonds with cytosine. The resulting double-strands are held together by hydrogen bonds which is an important characteristic for DNA. These weak bonds are stable, but can be separated when it is necessary. This process is necessary during DNA replication, when a duplicate copy of DNA is being made or during the denaturation step in PCR.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 12QP: DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What...

See similar textbooks

Similar questions

What is the complimentary DNA sequence to the strand below? C-G-G-T-T-A-G
A DNA strand consists of eight pairs of nitrogenous bases. How many different sequences of eight bases can you make? Explain how you found your answer.
Please help me to write the complementary strands of the following: 1. A strand of DNA has the base sequence ATGATC. Write the base sequence for the complementary strand. 2. A strand of DNA has the base sequence GATTCA. Write the base sequence for the complementary strand. Thank you very much for your help.
Write out the DNA sequence using the following instructions: This is a double stranded DNA hydrogen bonding with each other following the principle of complementary base-pairing Each strand contains ten nucleotides Each strand contains all four different types of nucleotides You should indicate clearly the directionality of each strand in your answer You do not need to draw the full nucleotide structure. Use the one-letter code (A, T, G, C, or U) to represent each nucleotide
What enzyme breaks the H-bond between nucleotides of DNA? Group of answer choices DNA gyrase DNA polymerase I DNA helicase DNA polymerase III
In one paragraph, using your own words, describe the structure of DNA. Be sure to include the following terms: nucleotide, phosphate, adenine, cytosine, guanine, and thymine.
A double-stranded DNA molecule is 1 cm long, and the percentage of adenine is 15%. How many cytosines does this DNA molecule contain?
Match the following terms with their correct definition. The structure of double-standed DNA Hold the base pairs together and make up the rungs of the DNA double helix One strand of nucleotides running in the opposite direction of the other strand Consists of a phosphate, a sugar backbone, and a nitrogen base A-T and C-G base pairs Five-carbon sugar found in DNA Answer Complementary base pairs Answer Double helix Answer Antiparallel Answer Nucleotide Answer Hydrogen bonds Answer Deoxyribose sugar
Which of the following statements are correct? explain your answers.A. A DNA strand has a polarity because its two ends contain different bases. B. G-C base pairs are more stable than A-T base pairs.
The template strand of a double helical segment of DNA consists of the following sequence: 5’- GTAGCCTTATCTAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACCATGTATAGTTG-3’ Use the given data to answer the succeeding questions and always indicate (and pay attention to) the DIRECTIONALITY of the strands in your answers. Part I. What is the nucleotide order in the complementary DNA strand? Part 2. What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? Part 3. What will be the overall anticodon sequence in tRNA? Part 4. Following the transitional process, what is the amino acid sequence that will be coded for? Show your answer using ONE-letter amino code starting from N-terminus to C-terminus Part 5. Following translational process, what is the amino acid sequence that will be coded for? Show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus.
If a double stranded DNA molecule is 20% thymine, what are the percentages of all other bases? 1. Adenine 2. Guanine 3. Cytosine
Can you please check my answer and make sure it is correct. Question: List the ingredients of master mix, and state the purpose of each ingredient. Answer: Taq DNA polymerase This enzyme synthesizes the complementary strand of the DNA template after attaching to the primer. This means that it adds on free nucleotides to the existing strand, but helps speed up the covalent bonding between these newly added nucleotides. This enzyme is also thermally stable meaning that it can withstand the hot temperatures needed for PCR to occur. This hot temperature is needed for the denaturation step when the double stranded DNA has to be unwound and separated into two strands. Individual building blocks of DNA (either free nucleotides A, T, C, and G or dNTP’s) These nucleotides are needed to build the complementary strand of DNA A special buffer to maintain the optimal pH, salts, and MgCl2 These buffers help maintain a good pH that doesn’t become too acidic or basic for Taq DNA polymerase to…