Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of DNA with the following base sequences: 5'CGGAC3'
Q: Give the base sequence of the complementary DNA strand of the DNA chain with the following base…
A: DNA is a macromolecule composed of individual subunits known as nucleotides. Each nucleotide…
Q: Write the sequence of the complementary DNA strand that pairs with each of the following DNA base…
A: The deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains. It coils around…
Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and…
A: DNA molecules store genetic material and two primary processes are necessary in order for DNA to…
Q: If the sequence of bases in one strand of DNA is 5′ TAGCCT 3′,then the sequence of bases in the…
A: Answer is c.) 3'ATCGGA5'.
Q: Write the complementary DNA strand for the following DNA base sequence: 5' СТСААG 3' 3' 5'
A: Central dogma consists of replication, transcription and translation. Replication is the synthesis…
Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…
A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…
Q: Give the DNA compliment to the following DNA strand. GTA SMH UUU GUA CAT
A: In DNA replication, the rule of complementarity is as follows- 1. Adenine (A) and Thymine (T) are…
Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…
A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…
Q: Draw a short segment of a single polynucleotide strand, including at least three nucleotides.…
A: A nucleotide has three components namely,(a) A nitrogenous base.(b) A pentose sugar (ribose in case…
Q: Two base pairs of double-stranded DNA are shown in the figure. Use your knowledge of base structure,…
A: DNA In DNA there are 4 bases Adenine, Thymine, guanine and cytosine. Adenine binds with Thymine…
Q: Match the following terms with their correct definition. The structure of double-standed DNA Hold…
A: Answer. The monomeric units of nucleic acids are called nucleotides. Nucleic acids, therefore, are…
Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…
A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…
Q: Write the sequence of the complementary strand of the following portion of a DNA molecule: 5…
A: DNA (Deoxyribonucleic acid) is the primary genetic material for most life forms. However, certain…
Q: Given the following sequence for one strand of a double-stranded oligonucleotide:…
A: Nucleic acids are of two types: RNA and DNA RNA It is referred to as ribonucleic acid. It is…
Q: Which of the following would be the correct complementary sequence to this strand of DNA: 5 ATTCGATC…
A: Question- Which of the following would be the correct complementary sequence to the strand of DNA…
Q: Give the complimentary DNA strand for the following: ACG TAG CTA GTC AGT CGT AGC Give the RNA…
A: NOTE:- Since you have posted a question with multiple sub-parts, we will solve the first three…
Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction…
A: ••Complimentary strand of DNA is made by by process of Replication Replication is process in which…
Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…
A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…
Q: A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the…
A: Ribonucleic acid (RNA) is a polymer of ribonucleotides that participate in diverse biological roles…
Q: Which structural feature of DNA is shown in the figure marked as "X"? (A
A: Introduction A DNA molecule consists of two strands that wind around each other like a twisted…
Q: Match the label on the left with the correct structure number in the DNA molecule in the image…
A: The given structure is of a alpha helix DNA. The DNA is composed of nucleotides. Nucleotide - The…
Q: Of the following DNA sequences which would you expect to have the highest melting temperature in its…
A: Melting temperature is defined as the temperature at which a double-stranded DNA molecule will break…
Q: Write the sequence of the complementary DNA strand thatpairs with each of the following DNA base…
A: A nucleotide is formed by nitrogenous base, sugar and phosphate. Commonly found bases in DNA are:…
Q: Match each DNA component to its corresponding point of attachment. 1. carbon 3' 2. carbon 5' 3.…
A: Deoxyribonucleotide (DNA) is a molecule containing all the genetic information needed to make each…
Q: Which of the following statements are true about double-stranded DNA? Write TRUE or FALSE 1. A+G=C+T…
A: DNA is a double stranded molecule with complementary base pairing. Complementary base pairing occurs…
Q: Which one of the three parts to a nucleotide is used to determine the 5' to 3' direction of a DNA…
A: A consequence of the structure of nucleotides is that a polynucleotide chain has directionality –…
Q: One strand of a DNA helix has the sequence: 5'-ATTGCCGTC-3'. Write the sequence of its complementary…
A: A DNA helix is an antiparallel helix that is wound on each other. It consists of two complementary…
Q: Fill in the palindromic sequence of the given DNA strand containing six bases. 5' GACGTC 3' 3' _ _…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Write the complementary sequence for the following DNA sequence, in order from 3' to 5':…
A: Deoxyribonucleic acid (DNA) is the hereditary unit of life, which carries the genetic information in…
Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…
A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…
Q: Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’…
A: Nucleus is main controller of the cell which carries genetic instructions . It contain Chromosome…
Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…
A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the…
A: Deoxyribonucleic acid (DNA) is a molecule with two chains of polynucleotides that wrap around one…
Q: Write the sequence of the DNA strand complementary to the following strand:…
A: DNA or Deoxyribonucleic acid is the double helical structure, present in each and every cell of all…
Q: If the sequence of the 5'-3' strand is AATGCTAC, then the complementary sequence has the following…
A: DNA is the double stranded structure. Both strand is antiparallel to each other, direction of one…
Q: Provide the sequence of the primer that is complementary to the DNA in each of the following…
A: Site A: 5' CTATGCGCTA 3'
Q: (a) Provide the sequence of the DNA complementary to the following strand (please write it in the 3'…
A: Complementary DNA Complementary DNA (cDNA) could be a DNA copy of a mRNA (mRNA) molecule created by…
Q: Tabulate the differences of the various DNA conformations in terms of orientation, rise per base…
A: The DNA duples model proposed by Watson and Crick was right handed spiral known as B-DNA. apart from…
Q: Given the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT…
A: Nucleic acids are present inside the nucleus to store and pass genetic information and thus controls…
Q: Look at the image of the the dinucleotide (two nucleotides joined togethr in a single strand). Base…
A: Nucleotide are the basic building blocks of DNA. A nucleotide consists of a sugar, nitrogenous base…
Q: Type the matching bases below in each DNA sequences. A T T C G A C G T C
A: DNA sequence composed of a row of chemical building blocks - called "bases". There are four types of…
Q: Give the DNA compliment to the following DNA strand. GAA CTT a b. GAA CUU BRB
A:
Q: Write the base sequence in a complementary DNA segment if each original segment has the following…
A: The cell is the basic primary unit of life for all living organisms. Inside this, the nucleus is the…
Q: Indicate the correct base order for the complementary DNA strand by placing the correct label in…
A: A DNA strand is formed of nitrogenous bases also called nucleobases. There are 4 nucleobases viz.…
Q: Draw the full structure of the DNA strand: 5'-ATG-3' To the above strand, draw the complementary…
A: Nucleic acid are the macromolecules which are of two types :- DNA and RNA DNA is deoxyribonucleic…
Q: Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and…
A: The complementary DNA sequence of DNA coding strand ATGATTATCCTATAG is TACTAATAGGATATC.
Q: If the length of E.coli DNA is 1.36 mm, calculate the number of base pairs it contains
A: Introduction: DNA (deoxyribonucleic acid) is the molecule that transmits genetic information for an…
Q: What is the nucleotide sequence of the DNA strand that is complementary to 5'-GGCGCAACTGTCACAA-3'
A: A nucleic acid sequence is a set of five letters that indicates the order of nucleotides in a DNA or…
Q: Write the sequence of a strand of DNA replicated using each of the following base sequences as a…
A: DNA replication is a process in which a template strand of DNA is replicated by forming a new strand…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
