Write out the DNA sequence using the following instructions: This is a double stranded DNA hydrogen bonding with each other following the principle of complementary base-pairing Each strand contains ten nucleotides Each strand contains all four different types of nucleotides You should indicate clearly the directionality of each strand in your answer You do not need to draw the full nucleotide structure. Use the one-letter code (A, T, G, C, or U) to represent each nucleotide

Write out the DNA sequence using the following instructions: This is a double stranded DNA hydrogen bonding with each other following the principle of complementary base-pairing Each strand contains ten nucleotides Each strand contains all four different types of nucleotides You should indicate clearly the directionality of each strand in your answer You do not need to draw the full nucleotide structure. Use the one-letter code (A, T, G, C, or U) to represent each nucleotide

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 15QP: Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw...

See similar textbooks

Similar questions

A beginning genetics student is attempting to complete an assignment to draw a base pair from a DNA molecule. The drawing is incomplete, and the student does not know how to finish. He asks for your advice. The assignment sheet shows that the drawing is to contain three hydrogen bonds, a purine, and a pyrimidine. From your knowledge of the pairing rules and the number of hydrogen bonds in A/T and G/C base pairs, what base pair do you help the student draw?
State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helix
Make the complementary strand for the following DNA template and label both strands as 5 to 3 or 3 to 5 (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA? template: PAGGCTCGOH new strand:
DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?
Below is the sequence of a single strand of a short DNAmolecule. On a piece of paper, rewrite this sequenceand then write the sequence of the complementarystrand below it.GTTCGCGGCCGCGAACComparing the top and bottom strands, what do younotice about the relationship between them?
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand
Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).
In clear and concise terms, explain how the biochemical structure of DNA allows it to function as the genetic material. DO NOT write about chemical structure of the monomers. It is about the aspects of the structure of helix that enable it to function as the genetic material. Write your answer in your own words, in 5-6 lines,
When DNA is heated, it denatures; that is, the strands separate because hydrogen bonds are broken and some base-stacking and hydrophobic interactions are disrupted. The higher the temperature, the larger the number of hydrogen bonds that are broken. After reviewing DNA base pair structure, determine which of the following molecules will denature first as the temperature is raised. Explain your reasoning. a. 5′-GCATTTCGGCGCGTTA-3′ 3′-CGTAAAGCCGCGCAAT-5′ b. 5′-ATTGCGCTTATATGCT-3′ 3′-TAACGCGAATATACGA-5′
Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’ (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).
draw a strand of DNA 4 nucleotides long (4 nucleotides on each side). Label the 5’ ends, the 3’ ends, the bond that holds the DNA backbone together, the glycosyl bond, and the bond that holds the nitrogenous bases together. You can use “P” to represent phosphate, and ATCG to represent the nitrogenous bases. Please try to draw the sugar accurately and include any unbonded functional groups, including the oxygen within the molecule.
draw a picture of a SINGLE strand of DNA (a polynucleotide) composed of 9 (nine) nucleotides of your choice. Do use ALL 4 nucleotides. Use 3 simple symbols to represent the phosphate, the sugar, and the base in each nucleotide. For example, use a circle with the letter “P” for the phosphate in the backbone, a square with the letter “S” for the sugar in the backbone, and a triangle with the letter “A, T, C or G” for the bases.As you draw the diagram be sure to put solid lines for the covalent bonds you are creating to join new nucleotides to the elongating DNA chain.