CDNAS and ESTS reveal exons or gene ends in genome searches Exon 2 Exon 1 Exon 3 Exon 4 Genomic DNA 240 241 528 529 696 697 816 3 CDNA 5' EST 3' EST ESTS FIGURE 14-10 Alignment of fully sequenced complementary DNAS (CDNAS) and expressed sequence tags (ESTS) with genomic DNA. The dashed lines indicate regions of alignment; for the CDNA, these regions are the exons of the gene. The dots between segments of CDNA or ESTS indicate regions in the genomic DNA that do not align with CDNA or EST sequences; these regions are the locations of the introns. The numbers above the CDNA line indicate the base coordinates of the CDNA sequence, where base 1 is the 5'-most base and base 816 is the 3'-most base of the CDNA. For the ESTS, only a short sequence read is obtained from each end (5' and 3') of the corresponding CDNA. These sequence reads establish the boundaries of the transcription unit, but they are not informative about the internal structure of the transcript unless the EST sequences cross an intron (as is true for the 3' EST depicted here).

CDNAS and ESTS reveal exons or gene ends in genome searches Exon 2 Exon 1 Exon 3 Exon 4 Genomic DNA 240 241 528 529 696 697 816 3 CDNA 5' EST 3' EST ESTS FIGURE 14-10 Alignment of fully sequenced complementary DNAS (CDNAS) and expressed sequence tags (ESTS) with genomic DNA. The dashed lines indicate regions of alignment; for the CDNA, these regions are the exons of the gene. The dots between segments of CDNA or ESTS indicate regions in the genomic DNA that do not align with CDNA or EST sequences; these regions are the locations of the introns. The numbers above the CDNA line indicate the base coordinates of the CDNA sequence, where base 1 is the 5'-most base and base 816 is the 3'-most base of the CDNA. For the ESTS, only a short sequence read is obtained from each end (5' and 3') of the corresponding CDNA. These sequence reads establish the boundaries of the transcription unit, but they are not informative about the internal structure of the transcript unless the EST sequences cross an intron (as is true for the 3' EST depicted here).

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…
Eukaryotic genomes are replete with repetitive sequences that make genome assembly from sequencereads difficult. For example, sequences such asCTCTCTCTCT . . . (tandem repeats of the dinucleotide sequence CT) are found at many chromosomallocations, with variable numbers (n) of the CT repeating unit at each location. Scientists can assemblegenomes despite these difficulties by using the pairedend sequencing strategy diagrammed in Fig. 9.9. Inother words, they can make libraries with genomicinserts of defined size, and then sequence both endsof individual clones. Following are 12 DNA sequence reads from sixcloned fragments analyzed in a genome project. 1Aand 1B represent the two end reads from clone 1, 2Aand 2B the two end reads from clone 2, etc. Clones1–4 were obtained from a library in which the genomic inserts are about 2 kb long, while the inserts inclones 5 and 6 are about 4 kb long. All of these sequences have their 5′ ends at the left and their 3′ endsat the right. To simplify…
The sequence at one end of one strand of the Drosophilatransposon Mariner is shown below (dots indicatesequences within the transposon):5′ TTAGTTTGGCAAATATCTCCCTTCCGCCTTTTTGATCTTATGT... 3′You obtain a mutant bacterial strain tagged with anengineered Mariner transposon, cut the genomicDNA from this strain with the restriction enzymeMboI (whose recognition site is ^GATC), and circularize the resultant DNA fragments by diluting therestriction enzyme digest and adding DNA ligase.a. Design two 17 bp PCR primers that you could useto identify (by inverse PCR) the gene into whichthe transposon inserted.b. What DNA sequence will be amplified from thecircularized fragments of the mutant genome?Show the extent of this DNA sequence on a mapof the genome of the mutant strain, indicating thelocations of the transposon insertion and any relevant sites for the enzyme MboI.
DNA polymerase I (Pol I) of E. coli consists of three functional parts (domains): an N-terminal domain with 59 to 39 exonuclease activity required for removal of the RNA primer, a central domain responsible for 39 to 59 exonuclease proofreading, and a C-terminal domain with polymerase activity. Pol I is thought to simultaneously remove RNA primers and fill in the gaps that result (figure 13.14). A group of proteins known as RNaseH also have 59 to 39 exonuclease activity and can thus remove RNA primers. However, they lack the other two functions observed for Pol I. Predict the ability of the following mutants to replicate DNA: (1) a strain with a mutant gene encoding Pol I such that it no longer has polymerase activity (but retains both types of nuclease activities); (2) a strain without RNaseH proteins; (3) a strain with a mutant gene encoding Pol I such that it no longer has 59 to 39 exonuclease activity (but retains 39 to 59 nuclease and polymerase activities); (4) a strain with the…
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?
A method for detecting methylated CpGs involvesthe use of a chemical called bisulfite, which convertscytosine to uracil but leaves methylated cytosine untouched. You want to know whether a particularCpG dinucleotide at one location in the genome ismethylated on one or both strands in a tissue sample.The genomic sequence containing this CpG is:5’...TCCATCGCTGCA…3’. You take genomicDNA from the sample tissue, treat it exhaustivelywith bisulfite, and then use flanking primers toPCR-amplify the region including this CpGdinucleotide. You then want to Sanger sequence(see Fig. 9.7) the amplified PCR product. a. After you treat genomic DNA with bisulfite, the twoDNA strands will melt into single strands. Why?b. Your answer to part (a) introduces a potential complication, because if you do not account for this result of bisulfite treatment, the PCR primers willnot amplify the DNA. What special considerationswould be necessary when you design your PCRprimers for this experiment? Could one pair…
In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’
One problem that researchers sometimes encounterwhen editing genomes with CRISPR/Cas9 is that oneor more loci other than the intended target can berecognized by Cas9/sgRNA and cleaved. Part of thereason is that single base pair mismatches betweenthe target site and the sgRNA in the 5′-most half of the 20 bp DNA/RNA hybrid do not prevent Cas9cleavage of the target site. How could scientists usebioinformatics to avoid such off-target effects?
3a)ClustalX software was used to perform multiple sequence alignment of thefollowing five Nco protein sequences designated as Nco1-Nco5 (the provided figure). A pair of degenerate primers was designed to PCR-amplify a DNA segment with the size of approximately 290 bp. With justification, discuss which amino acidsequence blocks would be suitable to design the forward and reverse degenerate primers.
The following figure shows a screen shot from the UCSC Genome Browser, focusing on a region of the human genome encoding a gene called MFAP3L. (Note hg38 refers to version 38 of the human genome RefSeq)a. Describe in approximate terms the genomic location of MFAP3L.b. Is the gene transcribed in the direction from the centromere-to-telomere or from the telomere-to-centromere?c. How many alternative splice forms of MFAP3L mRNA are indicated by the data?d. How many different promoters for MFAP3L are suggested by the data?
The following figure shows a screen shot from the UCSC Genome Browser, focusing on a region of the human genome encoding a gene called MFAP3L. (Note hg38 refers to version 38 of the human genome RefSeq)a. Describe in approximate terms the genomic location of MFAP3L.b. Is the gene transcribed in the direction from the centromere-to-telomere or from the telomere-to-centromere?c. How many alternative splice forms of MFAP3L mRNA are indicated by the data?d. How many different promoters for MFAP3L are suggested by the data? (please do not copy and paste the answer from below. i don't think it is correct. a. MFAP3L is mostly found in the nucleus in the genome. It is found on chromosome 4 reverse strand. The protein produced by the gene is found in the cell membrane, and it is positioned on the membrane with the carboxyl side of the protein facing the cytosol. b. The MFAP3L gene is transcribed from the telomere to the centromere. c. According to the data, there are 11 different splice forms…
The following figure shows a screen shot from the UCSC Genome Browser, focusing on a region of the human genome encoding a gene called MFAP3L. (Note hg38 refers to version 38 of the human genome RefSeq) a. Describe in approximate terms the genomic location of MFAP3L. b. Is the gene transcribed in the direction from the centromere-to-telomere or from the telomere-to-centromere? c. How many alternative splice forms of MFAP3L mRNA are indicated by the data? d. How many different promoters for MFAP3L are suggested by the data?