Answered: Choose all the items that catalyze the…

Choose all the items that catalyze the phosphodiester bond. - enhancer - promoter - activator - transcription factor - DNA polymerase - RNA polymerase

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter10: Control Of Gene Expression

Section: Chapter Questions

Problem 4SQ

See similar textbooks

Related questions

Q: Can you make a low power drawing of a lilium ovary and a high power drawing of an embryonic sac?

A: Approach to finding a solution to the problem:The first step in gaining an understanding of the…

Q: These types of proteins are responsible for all the following events during cell division: movement…

A: Approach to finding a solution to the problem:1. Determine the most important activities that take…

Q: Show the cross between a pure breeding dominant tall pea plant and a short plant in a punnet square

A: Pure-breeding means a homozygous genotype i.e. both the alleles present in the genotype of an…

Q: If 85% of diabetic patients are correctly identified by a urine test for glucose, but 25% of…

A: The objective of the question is to determine the sensitivity and specificity of a urine test for…

Q: GQ9

A: The question is asking us to identify the site on the ribosome where a tRNA molecule carrying the…

Q: Allowing all drunk-driving suspects (driving erratically) to complete the above sobriety test in 120…

A: The objective of the question is to understand the impact of increasing the time allowed for a…

Q: (a) 5' 3' GGCGCAGUGGGCUAGCGCCA (b) (((((..AAAAAA. ))))) (၁) AAAGGCCCAU aaaaaa.

A: The H-type pseudoknot is a common RNA structure composed of two helical stems (S1 and S2) and two…

Q: According to Aristotle’s density equation, if 4.686 grams of the sugar glucose (C6H12O6) occupies a…

A: 4. 1.562 grams/cm3Explanation:

Q: GQ Eight

A: Approach to solving the question:To identify the mutations in the Mc1r gene of the rock pocket mouse…

Q: 2B Determine, justifying your answer, which of the following statements are true. i. A trinucleotide…

A: ,The nucleic acids are two types. Those are 1. DNA (Deoxyribonucleic acid) and 2. RNA (Ribonucleic…

Q: GQ6

A: Approach to solving the question:Comprehending the variances in hair, skin, and eye color is…

Q: Are there any major differences between new world monkey skulls and strepsirrhines skulls? Take into…

A: Approach to Solving the Question:To comprehensively address the question, it's important to approach…

Q: Indicate if the following traits are indicative of (A) adenocarcinoma, (B) squamous cell carcinoma,…

A: Let's explore the different types of lung cancer based on your descriptions:Infrequently treated…

Q: House mouse (Mus musculus) Gene of interest: B4galnt2 (encodes glycosyltransferase enzyme) Allele R:…

A: Q.Explanation:- Hardy-Weinberg Principle:- Hardy-Weinberg is the principle which explains the…

Q: There is a new virus named Zmatanelia that is infecting monkeys in the UK. This is a novel virus and…

A: Sample Collection: Obtain tissue or bodily fluid samples from infected monkeys in the UK. Ensure…

Q: ستستتثهههس سنهص سنستةسةيةنويد ستستةسةهس ستوسونسموسة Ignore the previous text because I wrote it…

A: The objective of the question is to understand the best way to examine epithelial tissues under a…

Q: Which of the following ALL (Acute Lymphocytic Leukemia) FAB Type occurs most frequently in the…

A: The objective of the question is to identify the most common type of Acute Lymphocytic Leukemia…

Q: Which of Aristotle’s four causes is a definition of the substance of which something is composed?…

A: The objective of the question is to identify which of Aristotle's four causes refers to the…

Q: Anaerobic respiration requires great stores of glycogen requires extensive capillaries for oxygen…

A: The question is asking about the requirements and role of anaerobic respiration in human energy…

Q: 1. Write in a summary paragraph, to identify the test/stain in Microbiology. 2. Write in a summary…

A: Answer:1.In microbiology, several tests and stains are used to detect microorganisms. These include…

Q: 2. In dogs, barer trait is controlled by a dominant gene D and the silent trait by the recessive…

A: Question - 2.Note: There is a typing error in the question 2. In the table, under the heading…

Q: Genetics Q7

A: The question is asking about the effects of Xeroderma Pigmentosum, a rare genetic disorder that…

Q: please explain your answer

A: Step 1:Step 2:

Q: Need help with evolutionary biology problem

A: self-explanatory please give me a helpful rating if you are satisfied with the answer

Q: 7. The blood types of several members of a particular family were determined, and the results are…

A: Note: Since you have asked multiple questions, we will solve the first question for you. If you want…

Q: der these chemical species by increasing pH of an 0.1 M aqueous solution of each. That is, imagine…

A: Step 1: Step 2: I have given detailed step by step solution approach to solve this problem go…

Q: 8. In rabbits, coat color is governed by four alleles that constitute a multiple allelic series: C =…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: What are the benefits of multi-management protected areas as compared with strictly protected areas?…

A: They are more likely to benefit local people and thus earn local support: Multi-management protected…

Q: GQ3

A: The objective of this question is to understand the process of translation, which is a key part of…

Q: Rare forms of lymphoma include Question 7 options: A) Hodgkin and…

A: The question is asking to identify the rare forms of lymphoma from the given options.

Q: After challenges containing the outbreak, the Kelatavicla lab had to close in January 2018 . Six…

A: The objective of the question is to predict the frequency of the R allele in the mouse population…

Q: Genetics Q4

A: The question is asking where a tRNA molecule carrying the amino acid proline would be found in the…

Q: 3 Compound A is an optically active mixed triglyceride, for which the following apply: a) contains…

A: ### Triglycerides and Fatty AcidsTriglycerides are esters derived from glycerol and three fatty acid…

Q: how infectious pathogens are distributed , give 5 examples

A: The objective of this question is to understand how infectious pathogens are distributed and to…

Q: What differences do you notice between the male and female forms of extant apes?

A: Extant apes are the apes that are still alive today. There are six extant ape species: gorillas,…

Q: Which Roman deity was the wife of the second “sky-father”, and the mother of six Olympian gods and…

A: The question is asking for the Roman deity who was the wife of the second 'sky-father' and the…

Q: Answer the following questions regarding the diagram (below) showing translation. The ribosome is…

A: “Since you have posted a question with multiple sub parts, we will provide the solution only to the…

Q: NO3 reduction: 1. Explain the incubation conditions 2. Explain the reagents being added 3. Explain…

A: 1. The conditions of incubation Goal: By simulating the natural environment, the incubation…

Q: Which Roman Catholic Order is correctly matched with its favored metaphysical doctrine? the…

A: The Dominican Order, formally known as the Order of Preachers, was founded by Saint Dominic in the…

Q: Frank is learning about digestion. He asks, "Why doesn't the pepsin from the stomach digest the…

A: Together, these mechanisms ensure that the digestive enzymes, including pepsin, break down food…

Q: GQ15

A: The image you sent is related to alternative splicing, which is a process that removes certain parts…

Q: Which of the following is NOT secreted by the pancreas?

A: The pancreas is a glandular organ in the digestive system and endocrine system of vertebrates. It is…

Q: Plato and Aristotle agreed on which of the following philosophical doctrines? the metaphysical idea…

A: The question is asking us to identify the philosophical doctrine that both Plato and Aristotle…

Q: The Alexandrian physician Herophilus, originally from Chalcedon, was able to make which of the…

A: That a weak but rapid pulse was a sign of significantly increased blood volume: This conclusion…

Q: What is the null hypothesis for the above urine test for glucose? that glucose in the urine is a…

A: The objective of the question is to identify the correct null hypothesis for a urine test for…

Q: Based on the speculations of Nicole Oresme, and on the equation relating spatial distance, time,…

A: The objective of the question is to calculate the distance an object would travel when it is falling…

Q: What would the process be to use reverse osmosis to remove all the salt from the ocean to create…

A: The objective of the question is to understand the process of reverse osmosis and how it can be used…

Q: What does this figure from the bee paper show? a) Different bees are active at different times of…

A: The objective of the question is to interpret the data and figure provided from a research paper on…

Q: Which Platonic argument for the existence of God was rejected by St. Thomas Aquinas? the…

A: To answer this question, we first have to understand what each of these arguments is saying about…

Q: Which of the following mutations cannot be inherited by a person's biological children? A mutation…

A: The objective of the question is to identify which type of mutation cannot be passed on to a…

Question

Choose all the items that catalyze the phosphodiester bond.

- enhancer

- promoter

- activator

- transcription factor

- DNA polymerase

- RNA polymerase

AI-Generated Solution

AI-generated content may present inaccurate or offensive content that does not represent bartleby’s views.

Unlock instant AI solutions

Tap the button
to generate a solution

Click the button to generate
a solution

SEE SOLUTION

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which type of gene controls functions like an "on-off" switch for gene transcription? A. DNA methylation B. Phosphorylation C. translation D. protein degradation
-Nucleotides - U - T -Sugar & Phosphate - Anticodon - Codon - Ribose - Transcription - Translation - Replication Synthesis of RNA A base found in DNA Building blocks of DNA and RNA A base found in RNA 3 letter code on tRNA Synthesis of DNA Backbone of DNA 3 letter code on mRNA Sugar found in RNA Synthesis of proteins
During gene expression, which information flows in the correct order? A. RNA --> Transcription--> DNA B. Proteins --> Translation --> RNA C. DNA --> Transcription --> RNA D. RNA --> Transcription --> Proteins E. DNA --> Translation --> RNA
Describe the process of transcription in your own words, using the following terms: activator, enhancer, promoter, DNA bending protein, RNA polymerase, transcription factors, mRNA transcript.
During transcription, 1 nucleotide of DNA corresponds with ________ nucleotide of RNA: A. 1 B. 2 C. 3 D. 4
The transcription factors would recognize and bind to nucleotides between the positions _____________________________. Group of answer choices A. +1 to +55 B. -1 to -22 C. -16 to -22 D. +1 to +25
The "TATA box" is a [DNA, RNA, Carbohydrate, protein] sequence known as a [promoter, start codon, n-terminus, 5' end] that signals areas where [translation, transcription, replication, protein sequencing] should begin.
Why siRNA phenomenon is utilized in cell biology? Because specific gene silencing leads to blocking protein translation Because specific gene silencing leads to blocking mRNA transcription Because specific gene silencing leads to blocking DNA replication All answers are correct
A promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA nucleotides c. a protein that binds to DNA d. an enzyme that synthesizes RNA
Binding of _______ to _______ in DNA can increase the rate of transcription of specific genes. a. activators; repressors c. repressors; operators b. activators; enhancers d. repressors; enhancers
Which process is the result of the post transcriptional modification of mRNA? Group of answer choices removal of exons and joining of introns that will exit nucleus transcription of DNA & RNA polymerase protection of 5’ cap & 3’ poly-A tail replication of helicase and gyrase
Which DNA regulatory sequence speeds up transcription? a promoter b repressor c silencer d enhancer