Comparing chymotrypsin and subtilisin active site geometries on the assumption that their similarities have catalytic importance has improved mechanistic knowledge of both enzymes (which they did not). Can you evaluate this approach?

Comparing chymotrypsin and subtilisin active site geometries on the assumption that their similarities have catalytic importance has improved mechanistic knowledge of both enzymes (which they did not). Can you evaluate this approach?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter25: Nitrogen Acquisition And Amino Acid Metabolism

Section: Chapter Questions

Problem 22P

See similar textbooks

Related questions

Q: Give the molecular and structural formulae for: –2 examples of structural isomers of monosaccharides…

A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…

Q: Prepare a schematic diagram and present it as though it were a Figure in a publication (scientific…

A: Binding of ligand to receptor or protein can be specific and non-specific. For the genuity of the…

Q: Deficiency in HGPRT will lead to what? a. No synthesis of ATP b. No salvage pathway for all purines…

A: Hypoxanthine- guanine phosphoribosyl transferase (HGPRT) is required in salvage pathway which is…

Q: You want to digest 1 µg of plasmid DNA in a final volume of 50 µL. Your solution containing plasmid…

A: A plasmid is an extrachromosomal DNA molecule within a cell that is distinct from chromosomal DNA…

Q: c. In lab, you recorded a UV-Vis spectrum of a mixture of proteins. What best explains why two major…

A: (c). Every substance absorbs a certain amount of energy, when a light of particular intensity…

Q: 4 Using the structures you drew in questions 2 & 3, for each of the organic functional groups listed…

A: The structures of the compounds from questions 2 and 3 are given below (lecithin) The…

Q: Hydrogen bonds in water: (one or more may apply) Group of answer choices create surface…

A: Introduction :- The questions are all about the water molecules, their bonding pattern, the bond…

Q: Draw the following Lipids in A) Condensed (detailed) Structure, B) its Block Diagram. C)…

A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…

Q: 1.b)Which one of the following would produce the most reliable evidence? in vitro study case report…

A: There are several different types of study designs that are used to gather evidence, each with its…

Q: ) Describe the 10 enzymatic reactions of glycolysis and the organization of the pathway in 2 main…

A: Glycolysis is a metabolic pathway during which glucose molecule splits into pyruvate molecules with…

Q: A. Given the following piece of messenger RNA (mRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAG…

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: Which one of the following statements concerning the nature of fats is correct? Saturated fats are…

A: Simple fat or fat or triglycerides are fatty acid esters of glycerol. They serve as fuel reserves…

Q: The catalytic mechanism of an enzyme found in the mitochondrial matrix (pH = 7.8) depends on an…

A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…

Q: What are the two monosaccharides that make up this structure? H₂N НО CH3 OH OH H NH₂ N

A: Carbohydrates or carbs are maconutrient consisting of Carbon, hydrogen and oxygen atoms. In nature…

Q: 1. Calculate a creatinine clearance and its reference range. 2. Explain the biochemical formation…

A: Since you have posted multiple questions, we will provide the solution only to the first question as…

Q: In which phase of aerobic respiration is the main part of ATP formed? Electron transport chain…

A: Cellular respiration is a collection of three metabolic pathways that generate ATP by the oxidation…

Q: 1.a)Which one of the following vitamins is fat-soluble? Vitamin B12 Vitamin D Vitamin B1 Vitamin B3…

A: Introduction Vitamins are the organic substances which is required for our growth and development.…

Q: What do vaccines introduce into the body? short chain fatty acids antibodies lymphocytes phagocytes…

A: vaccines are biological preparations that help to stimulate an individual's immune system to produce…

Q: The graphs 3 and 4 representing 1/Vo = f(1/[S]。) have been done in the presence of a competitive…

A: Enzymes carry out most of the processes required for life. They are protein in nature and carry out…

Q: How to control or take care of microbial metabolism?

A: Microbial metabolism is the pathway followed by microorganisms to obtain the energy (carbon source)…

Q: please answer and expalin in detail Please provide only typed answer solution no handwritten…

A: The citric acid cycle (also known as the TCA cycle or Krebs cycle) is a series of chemical reactions…

Q: 1. Lyticase is an enzyme that breaks down cell membranes. It is particularly useful when harvesting…

A: During enzyme kinetics, the primary plot we use is the Michaelis-Menten plot with [S] as X-axis and…

Q: The rate of transformation of S, have been determined in the presence of two compounds M and N.…

A: Enzyme Inhibitors are the substances that can bind to enzyme and inhibit the enzyme activity . On…

Q: Glucose-6 Phosphate Dehydrogenase and TPI Deficiencies 2 H+ Glucose-6-P GSH + GSH Reduced…

A: Introduction G6PD (Glucose-6-Phosphate Dehydrogenase) is an essential enzyme in glucose metabolism,…

Q: In a case where the energy source to be used it 1 malate unit, exactly how many ATP can be yielded?…

A: Cellular respiration is a collection of three metabolic pathways that generate ATP from oxidation of…

Q: Question 37 The following peptides were measured for a longer sequence that you are interested in…

A: The proteins are composed of twenty naturally occurring amino acids. According to Anfinsen's…

Q: The table below gives the initial velocities of a decarboxylase, determined at various [S], in the…

A: Km is the Michael's menton constant which can be determined as the substrate concentration at half…

Q: 1. Describe the accuracy and specificity of Nelson-Somogyi method 2. Do you think PFF should be…

A: Since you have posted multiple questions, we will provide the solution only to the first question as…

Q: Arrange the steps in the reaction catalyzed by threonine dehydrates in order, using the racemization…

A: Threonine dehydratase catalyzes the conversion of threonine to α-ketobutyrate , H2O and NH3 . The…

Q: 1.2 Ninhydrin Test Substance 2% glycine 2% gelatin 2% albumin 1% tyrosine casein + distilled water…

A: Ninhydrin test : It is the alpha-amino groups in proteins and amino acids that are responsible for…

Q: The glycolytic enzyme aldolase catalyzes the following cleavage reaction: Fructose 1,6-bisphosphate…

A: Aldolase is an enzyme that catalyses one of the reaction of glycolytic pathway by performing a…

Q: True or false - metabolism of triglycerides generate water - sphingolipids are formed from glycerol…

A: Fatty Acids belong to one of the major classes of Biomolecules that is Lipids. It is the main…

Q: For the study of alanine production by a recombinant strain of E. coli, cultivation was carried out…

A: A recombinant strain is a type of genetically modified organism (GMO) that has been artificially…

Q: sucrose + lactase being combined was meant to demonstrate 1. enzymes are specific to their…

A: Enzymes are biocatalyts which are generally protein in nature except ribozyme. Sucrose is a…

Q: - Draw the graph A340 = f(t). Comment the shape of the curve Calculate alanine, LDH, NADH and…

A: If a particular reaction brings about a measurable change (like the generation or consumption of a…

Q: The phosphates that make up the phosphodiester bonds in DNA have pka 2. The genome of the blue crab…

A: pH is a measure of the acidity or basicity of a solution. It is defined as the negative logarithm of…

Q: 1.a)From the countries listed which one has the highest percentage of household expenditure towards…

A: Food is an essential requirement for any organism. Food is any substance that is consumed by an…

Q: RC B H₂N-C- C A B H This content is protected and may not be shared, uploaded, or distributed. C A D…

A: Amino acids are the building blocks of protein. Structurally they contain compounds such as carbon,…

Q: 1. 2. 3. Why does casein precipitates upon the addition of acetic acid? Why is milk used as an…

A: Casein is a phosphoprotein found in milk and so also called as milk protein. It has an isoelectric…

Q: 1. Why is β-carotene less polar than chlorophyll b? Mention any TWO functional groups which make…

A: Beta-carotene- an isoprenoid compound, synthesized in plants, fungi, is an accessory pigment…

Q: What are the vitamin derivatives of the following A. Nicotinamide coenzyme B. Flavin coenzyme C.…

A: Vitamins are the organic compounds that are vital for the health of an individual. Vitamins are…

Q: T F T F T F T T F F T F T F Vmax is the velocity observed when all of the enzyme present is fully…

A: The kinetics of an enzyme-catalyzed reaction can be described using a variety of parameters,…

Q: Reabsorption of this substance involves carbonic anhydrase - inulin - bicarbonate - glucose -…

A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation…

Q: Why does the lack of carnitine causes hypoglycemia, muscle weakness? Justify the answer…

A: INTRODUCTION : Hypoglycemia : It is a disorder or condition in which the levels of the body's blood…

Q: For the reaction A + 2 B 3 C + D, what is the magnitude of the rate of change for [D] when [C] is…

Q: 1. what cause the reaction of the rancid oil to ph paper to be different from that fresh oil 2.…

A: The biological macromolecules can be classified a nucleic acids, proteins, lipids and carbohydrates.…

Q: IDENTIFICATION: 1.Complex organic compound w/c has the ability of speeding chemical reactions w/out…

A: Since you have posted multiple questions, we will provide the solution only to the first five…

Q: What enzyme will not be used if the oxidative portion of the pentose phosphate pathway is operating…

A: The pentose phosphate pathway also called the hexose monophosphate shunt is an alternative pathway…

Q: 5. The amino acid sequences of three peptide fragments are shown below. Peptide 1: QAMGRAGDLKYLGLHSV…

A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have…

Q: When the enzyme is incubated with iodoacetate, it is observed that glyceraldehyde-3- phosphate still…

A: Enzymes are made up of amino acids, and the sequence as well as the arrangement of those amino acids…

Concept explainers

Types of database architectures

A Database Architecture represents the Database Management System’s (DBMS) design (schema). The DBMS architecture makes it easy to understand the components involved in the database system and their relations. The DBMS architecture may vary based on the system on which it runs. Some systems contain both client and server machines whereas some run only on a server machine. Based on the architecture, the system can be classified as centralized, decentralized, or hierarchical.

Question

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

The comparison of chymotrypsin and subtilisin active site geometries on the assumption that their similarities had catalytic importance has improved mechanistic knowledge of both enzymes (which they did not). Is this technique effective?
The comparison of the active site geometries of chymotrypsin and subtilisin under the assumption that their similarities have catalytic signifi cance has led to greater mechanistic understanding of both these enzymes. Discuss the validity of this strategy.
Increased mechanistic knowledge of both chymotrypsin and subtilisin enzymes has emerged from comparing their active site geometries in the hope that their commonalities would have catalytic importance (which they did not). Are you able to discuss the efficacy of this strategy?
Mechanistic insights into the catalytic mechanisms of chymotrypsin and subtilisin were gained by a comparison of their active site geometries (which they did not). What do you think of the effectiveness of this strategy?
Comparing the active site geometries of chymotrypsin and subtilisin enzymes under the hypothesis that their similarities had catalytic importance led to a greater mechanistic knowledge of both enzymes (which they did not). Can you discuss the efficacy of this tactic?
Briefly describe why the Michaelis-Menten equilibrium-assumption cannotbe applicable to all enzyme-catalyzed reactions
Enzymes are stereochemically specific; that is, they oftenconvert only one stereoisomeric form of substrate intoproduct. Why is such specificity inherent in theirstructure?
Consider two enzymes A and B, which are not related. However, the two enzymes coincidentally share the same value for Vmax. Using this information, can you derive conclusions how the km values for enzymes A and B compare to each other?
Following this experiment, you would like to elucidate the mechanism of action of pyruvatekinase. Unfortunately, the crystal structure of pyruvate kinase is not available, whichrequires the enzyme to be modelled based on the available three-dimensional structures ofrelated enzymes. Suggest a bioinformatics approach that can be conducted to perform thisstudy.
Many enzyme -catalyzed reactions are consistent with a modified version of the Michaelis -Menten mechanism in which the second step is also reversible. For this mechanism obtain an expression for the rate of formation of product and find its limiting behavior for large and small concentrations of substrate using steady state approximation
Some enzymes have catalytic activity only limited by diffusion. Which rate constants of an enzyme- catalyzed reaction is/are rate limiting for the enzyme? How does this line up/compare to the rate limiting step of Michaelis-Menten Enzyme Kinetics? (Please show work and correct answer)
The uncatalyzed reaction rate for the conversion of substrate X to product Y is one year. The enzyme-catalyzedrate is one millisecond. Describe the features of theenzyme that are probably responsible for this ratedifference.