Complete the following sentence: RNA splicing removes the non-coding sequences (_----_) from pre-MRNA, and joins the remaining coding sequences (__) to produce an mRNA strand with a continuous coding sequence. introns ; exons 3' end; 5' end exons; introns 5' end; 3' end

Complete the following sentence: RNA splicing removes the non-coding sequences (_----_) from pre-MRNA, and joins the remaining coding sequences (__) to produce an mRNA strand with a continuous coding sequence. introns ; exons 3' end; 5' end exons; introns 5' end; 3' end

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Related questions

Q: What happens to the pre-mRNA before it migrates to the cytoplasm? Explain

A: Answer: TRANSCRIPTION : It is the process in central dogma where DNA is transcribed in to RNA by…

Q: Which enzyme removes a phosphate from the 5' end of the MRNA, leaving two phosphates?

A: mRNA is a messenger RNA, it is a single stranded RNA which carries the genetic sequence of the DNA…

Q: Which of the following segments of RNA are retained after conversion of a pre-mRNA to a mature mRNA?…

A: RNA: it is of different types such as rRNA, tRNA, mRNA etc.

Q: If the DNA gene reads AAT GGT CCA CCG CTG, what will the MRNA read? O A. TTA CCA GGT GGC GAC O B.…

A: DNA is a macromolecule and is composed of nucleotides having sugar , phosphate and nitrogenous bases…

Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…

A: Hi, Thanks For Your Question. Answer : Let's Learn Some Basic Concepts First: Transcription : It Is…

Q: mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping.…

A: A codon is a triplet of the mRNA sequence, which identifies an amino acid. The genetic code tells…

Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Select an answer and…

A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…

Q: Use the following segment of DNA to determine the mRNA and amino acid sequence that would form.…

A: DNA and RNA are two different forms of nucleic acids, which are biological polymers of nucleotides.…

Q: Explain why the statement is correct. A section of the mRNA has a nucleotide sequence of…

A: mRNA A single stranded RNA which is copied from DNA and contains gene or information about specific…

Q: describe the process of reading a gene and turning it into a protein in a eukaryote.Your first…

A: Transcription: The process of conversion of segment of the DNA to RNA is called as Transcription.…

Q: Which sequences within the pre-mRNA determine where splicing occurs?

A: RNA splicing is a process that produces a mature mRNA from a pre-mature mRNA. The process is started…

Q: Number the following steps of protein synthesis in order in which they occur, starting with 1 and…

A: Translation - it the process in which proteins are formed from ribosomes particularly,from mRNA…

Q: The sequence below is an mRNA strand that is in the cytoplasm ready to translated by a ribosome. If…

A: Translation is the process of formation of a protein chain from a RNA chain. Translation requires an…

Q: RNA Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 Intron 3 Exon 4

A: Eukaryotic primary transcripts are split. That is, they are composed of coding sequences for…

Q: Which components will end up in the final, fully processed mRNA in a eukaryotic cell? Choose all…

A: The m RNA that is formed by the process of transcription from DNA is subjected to pre-processing in…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Missense mutation is the mutation in which single amino acid change occurs. The other amino acid in…

Q: The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’…

Q: Without using your textbook, determine what protein sequence would be translated from the mRNA…

A: DNA is the store house of genetic information. This information is in the form of nucleotide…

Q: Number the following steps of protein synthesis in the order in which they occur, starting with 1…

A: Central dogma involves transcribing the information from DNA to RNA and from RNA to protein…

Q: How long is the polypeptide produced from the following mRNA transcript?…

A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…

Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…

Q: Analyze the following amino acid sequence and write down a potential mRNA sequence from which this…

A: The mRNA is "read" by the genetic code during translation that constitutes the second major stage in…

Q: Complete the phrases with the correct word or words. The task is to match the lettered items with…

A: Genes are sets of nucleotides that codes for a particular protein. The genes have to be expressed…

Q: Which sequences are spliced out of the mRNA strand before leaving the nucleus? In other words,…

A: Answer: TRANSCRIPTION : It is the process in central dogma where a DNA strand is transcribed in to…

Q: Given the following mRNA sequence, write the peptide sequence that will result from protein…

A: mRNA stands for messenger RNA( Ribonucleic acid). Protein translation is a process of making…

Q: If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What…

A: The central dogma of life states that there is a unidirectional flow of information from master copy…

Q: DNA: TACGGGCCTATACGCTACTAC T CATGGATC Corresponding MRNA sequence: Corresponding amino acid sequence…

A: DNA consists of two strands which wind around each other, backbone of the DNA is formed by the…

Q: You have an mRNA transcript that is 201 nucleotides long, including the Start and Stop codons. How…

A: In most living organisms, DNA is the genetic material. DNA contains all the genetic instructions…

Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Cytoplasm Endoplasmic…

A: The stability of mRNAs varies considerably in the case of eukaryotic organisms. Some mRNAs have very…

Q: Choose the option that goes with the blank. The parentheses after the blank are the choices.…

A: In the process of synthesis of proteins from DNA, the information in DNA is used for the synthesis…

Q: The following gene sequence of nucleotides is found on the template (non-coding) strand of a…

A: The sequence would be opposite to template strand and similar to coding strand(except the thiamine…

Q: The following sequence is the coding strand of a piece of DNA. Type out the corresponding template…

A: The protein sequence can be decoded by a coding or template DNA given. The mRNA strand is the same…

Q: What polypeptide is coded for by this mRNA sequence? 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'

A: Codons are trinucleotide sequence (DNA, RNA) that codes for specific amino acid and chain of amino…

Q: Complete the following table: Type of RNA Functions Transfer RNA (tRNA) In a ribosome,…

A: Macromolecules are very large molecules commonly composed of the polymerization of smaller subunits…

Q: The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What…

A: The process of making a copy of genetic information stored in a DNA strand to a complementary strand…

Q: Write the amino acid sequence based on the following portion of MRNA. Write the name of the amino…

A: The codons which are present on mRNA are will code for specific amino acids based on genetic code…

Q: How many amino acid are in each of the two polypeptides produced? And how many nucleotides long…

A: The amino acids are produced by the DNA (deoxyribonucleic acid) through processes called…

Q: The following segment of DNA codes for a protein. The uppercase letters represent exons. The…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: A segment of mRNA produced by the normal order of DNA nucleotides and the corresponding amino acid…

A: Introduction Genetic code or codon is a three nucleotide sequence present on mRNA. It gives the…

Q: Below is an mRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz…

A: This mRNA sequence have so many genetic code. There are some numerical value on genetic code but all…

Q: Which three codons would code for a different amino acid sequence from that coded for by the mRNA…

A: Given: mRNA base sequence: AGU-UCA-CCA Have to determine which three codons will code for a…

Q: What happens when one base pair of DNA is lost from the coding region of a gene because of mutation?…

A: This type of mutation is known as Deletion mutation in which a single or entire sequence of…

Q: In the space below, list the events that would occur during the processing of a primary RNA…

A: The primary transcripts selected to be mRNAs are adapted in preparation for translation. Precursor…

Q: What protein sequence would a cell make from the following mRNA? 5'- CCAUGCACCAAUAGAUAACCG-3' O PCTN…

A: During the translation, the sequence of nucleotides in the mRNA is translated into a sequence of…

Q: What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG…

A: DNA is genetic material which is involved in transfer of information into the protein. It involves…

Q: Which components will end up in the final, fully processed MRNA in a eukaryotic cell? Choose all…

A: Post-transcriptional modifications are chemical modifications of the primary RNA transcript to…

Q: A mRNA has the following sequence and direction: 5’-AUGUCAACCUAA-3’ What would be the anticodon…

A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…

Q: Name the process in which unwanted mRNA regions are removed & wanted regions are joined.

A: Transcription is a process in which the DNA template is synthesized into mRNA. At the end of…

Q: If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the…

A: DNA strand – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…

Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…

A: Amino acids are the organic compounds that contain the amino group (–NH2) and carboxyl group(–COOH)…

Question

Complete the following sentence: RNA splicing removes the non-coding sequences
(-----) from pre-MRNA, and joins the remaining coding sequences ( to
produce an mRNA strand with a continuous coding sequence.
introns ; exons
3' end; 5' end
exons; introns
5' end; 3' end

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA
Portions of eukaryotic mRNA sequence that are removed during RNA processing are . a. exons b. caps c. poly-A tails d. introns
Shown below is the 5' end of an mRNA molecule. What are the first three (N-terminal) amino acids of its protein product? 5'-AUGUGUUGAUGUAUCAGACCUGUC ---
Given below is the mRNA sequence that encodes the amino acids of a protein. Based on the mRNA sequence predict the amino acid sequence that it encodes. Please list the protein sequence as SINGLE letter amino acids.mRNA: -AUGACACCACUCCACUUAUAGCCCUAA-
The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’
Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine? Group of answer choices 5’-UACCUAGCU-3’ 5’-GUGCAAUUU-3’ 5’-AUGGUAACA-3’ 5’-GGUCGCCAU-3’
Without using your textbook, determine what protein sequence would be translated from the mRNA sequence 5’-UAUACUCCAUGC-3 A. Pro-Arg-Gly-Leu B. Leu-Arg-Cys-Thr C. Met-Cys-Ala-Ala D. Tyr-Thr-Pro-Cys E. None of the above
An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.
Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG
Complete the phrases with the correct word or words. The task is to match the lettered items with the correct numbered items. Appearing below is a list of lettered items. Following that is a list of numbered items. Each numbered item is followed by a drop-down. Select the letter in the drop down that best matches the numbered item with the lettered alternatives. a. methionine b. ribosome c. codon d. AUG e. UAC The mRNA moves out of the nucleus and attaches to a The first codon of an mRNA molecule is always As soon as the first codon is in place, a tRNA molecule arrives with the anti-codon The first tRNA to arrive always carries the amino acid called, The ribosome scoots along the mRNA to read the next