Concept explainers
A certain mRNA strand has the following
What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.)
Figure 13-5 The genetic code
The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (“start”). Three codons—UAA, UGA, and UAG—do not specify amino acids; they terminate polypeptide synthesis (“stop”).
Trending nowThis is a popular solution!
Chapter 13 Solutions
Biology (MindTap Course List)
- The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNAarrow_forwardIf the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. fivearrow_forwardThe fourth codon in an mRNA is GGG, which specifies glycine. If we assume that no amino acids are removed from the polypeptide, which of the following statements is correct?a. The third amino acid from the N-terminus is glycine.b. The fourth amino acid from the N-terminus is glycine.c. The third amino acid from the C-terminus is glycine.d. The fourth amino acid from the C-terminus is glycine.arrow_forward
- In translation of an mRNA into a protein, the first amino acid that is attached to the start codon is which of the following? a. O-formylmethionine b. Serine c. N-formylmethione d. Cysteinearrow_forwardDNA gene TAC AGC TTT mRNA codon (No thymine in RNA!) tRNA anticodon (No thymine in RNA!) Amino acid Use the mRNA with the Genetic Code. Use the mRNA with the Genetic Code. Answer the questions below. Questions How many nucleotides would be needed to code for a protein that has 100 amino acids? Using the Genetic Code in Table 6.3, write all of the possible codons that signal the start and end of a gene. Start: End: An amino acid sequence of a protein molecule includes methionine, lysine, serine and glycine. Show each different codon that could result in each of these amino acids. You will have more than one codon for all of them except methionine. Amino Acids All Possible Codons Methionine Lysine Serine (Look carefully. There are six possibilities) Glycine Question 3 illustrates the redundant nature of the genetic code. Can you think of an advantage of having several codons that all code for the…arrow_forwardTranscribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: C G A T A C A A T G G A C C C G G T A T G C G A T A T C C mRNA: G C U A U G U U A C C U G G G C C A U A C G C U A U A G G Codon: Anitcodon: Amino Acids:arrow_forward
- Which of the following describes the interactions between a codon and an anticodon? A. A codon and an anticodon become covalently bonded together due to the activity of the ribosome. B. A codon and anticodon do not come into direct contact because codons are in the nucleus but anticodons are in the cytoplasm. C. A codon and anticodon are attracted to each other due to hydrogen bonding. D. A codon and an anticodon are linked together by an amino acid. ..arrow_forwardIf given the following coding strand of DNA, what is the mRNA? What tRNA will be present? (hint - draw this!) DNA: A A A C C G A T C C T T A A T G G C T T A mRNA: tRNA:arrow_forwardAn mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.arrow_forward
- Consider a portion of a gene in a cell with the sequence TTTTT. Which of the following bases would you find in the complementary RNA strand, and where in the (eukaryotic) cell would this RNA be synthesized? A) A-A-A-A-A; ribosome B) U-U-U-U-U; ribosome C) A-A-A-A-A; nucleus D) U-U-U-U-U; nucleusarrow_forwardAll of the following are true about translation EXCEPT _____. as the ribosome moves from codon to codon, amino acids brought by successive tRNAs to the ribosome form a growing polypeptide when the ribosome reaches a stop codon, its subunits detach, and the mRNA and new polypeptide are released RNA polymerase assembles a strand of mRNA complementary to the coding strand of DNA Ribosomal subunits and a tRNA-carrying methionine converge on the start codon of an mRNAarrow_forwardThe amino acid glycine is encoded by four codons: GGA, GGC, GGG, and GGU. Which of the following statements correctly explains this fact? The glycine anticodon contains the sequence CC, but the 5' base of the anticodon can pair nonspecifically with the 3' base of the codon. The glycine anticodon contains the sequence CC, but the 3' base of the anticodon can pair nonspecifically with the 5' base of the codon. Glycine tRNA has four anticodons, and the appropriate anticodon specifically pairs with the correct codon. There are four tRNAs for glycine, each of which has an anticodon that specifically pairs with the correct codon. all of the abovearrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning