Write the amino acid sequence based on the following portion of MRNA. Write the name of the amino acid that is found at the c-terminus. 5'.AUGCUGUCCUACCCCUUCAAAGAGGAU.3'
Q: Please help me find the protein sequence in reference to the text below. "mRNA Sequence…
A: Cell is the basic structural and functional unit of life. The nucleus in the cell contains the…
Q: The following is a strand of mRNA: CAA GUG AAA ACA How many amino acids does the mRNA strand above…
A: The protein synthesis process requires the genetic material in the form of DNA to be transcribed…
Q: In the diagram below, identify the mRNA by clicking on the correct highlighted portion. TACGGGCTA A…
A: Alleles are considered as the variant of the gene. DNA is composed of different nucleotides that…
Q: Which amino acid sequence will be generated during translation from the following small mRNA:…
A: According to the hint given then the start codon is AUG (Met) The stop codon is UGA .
Q: The mRNA sequence AUG CAC AGU codes for the first three amino acids of a particular protein. Which…
A: The mRNA synthesized after transcription process undergoes translation to synthesize proteins. The…
Q: If the template strand of DNA has the sequence 5'AATGCCTATA3', the MRNA sequence that is transcribed…
A: Transcription is the first of several steps in gene expression in which a particular segment of DNA…
Q: Use the following segment of DNA to determine the mRNA and amino acid sequence that would form.…
A: DNA and RNA are two different forms of nucleic acids, which are biological polymers of nucleotides.…
Q: Explain why the statement is correct. A section of the mRNA has a nucleotide sequence of…
A: mRNA A single stranded RNA which is copied from DNA and contains gene or information about specific…
Q: A section of an mRNA has the following nucleotide sequence: ACU UGC AGU GGU GUA For the mRNA…
A:
Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the…
A: Protein is the final product of a gene that determine the phenotype of the organism. Protein…
Q: Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the…
A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…
Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…
A: The process of producing protein by association of mRNA and ribosomes is called translation. The…
Q: list the amino acid sequence that would be made in a ribosome using these codons: AUG CUA AGU…
A: A ribosome consists of two basic pieces of units containing a large and a small subunit. During the…
Q: If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequence
A: DNA is the double helix structure. Two complementary strands present in the DNA. The direction of…
Q: Use the table of the codons to answer the following question. Starting with the start codon, what is…
A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a…
Q: In the DNA sequence,the bottom strand is a template strand.if the base pair
A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…
Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…
A: An open reading frame in molecular genetics describes the part of your reading frame that has the…
Q: An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon,…
A: In Amazon instant there are four type of nucleotide bases i.e adenine, guanine, cytosine and uracil.…
Q: If a DNA sequence is 5’ CGCTAGACT 3’, the complementary DNA sequence will be? If a DNA sequence is…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: If given the following coding strand of DNA, what is the mRNA? What tRNA will be present? (hint -…
A: DNA is a hereditary molecule made up of two polynucleotide chains lies in the nuclues of all…
Q: On the mRNA codon table below, the first nucleotide in mRNA is to the left, the second is above, and…
A: The DNA is transcribed into mRNA by the process of transcription and this mRNA is translated into…
Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…
A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: b) the sequence of the…
A: The given DNA sequence is as follows 3’–CGATACGGCTATGCCGGCATT–5' The above given strand is a…
Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…
A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.
Q: Given the following mRNA sequence, write the peptide sequence that will result from protein…
A: mRNA stands for messenger RNA( Ribonucleic acid). Protein translation is a process of making…
Q: An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start…
A: RNA (Ribo Nucleic Acid) is the genetic material found in prokaryotes and eukaryotes. It is the prime…
Q: Translate the following mRNA into protein, starting from the first initiation codon:…
A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…
Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…
A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…
Q: Provide the abbreviation for the amino acid sequence expected from the following MRNA segment using…
A: Following amino acid sequence is predicted.
Q: Using the genetic code, interpret the following set of nucleotides.…
A: The genetic code is a set of rules that living cells use to convert information found in genetic…
Q: Assume the following portion of an mRNA. Find a start signal, and writethe amino acid sequence that…
A: The process in which amino acid is incorporated into the polypeptide chain with the help of a…
Q: Given the following DNA sequence from the template strand of a given gene:…
A: Codon is a sequence of three nucleotides which together form a unit of genetic code in a DNA or RNA…
Q: Determine which amino acid is formed from the following mRNA codon: GUA. a aspartic acid b…
A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…
Q: Below is an mRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz…
A: This mRNA sequence have so many genetic code. There are some numerical value on genetic code but all…
Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…
A: Introduction According to Chargaff's rules, DNA from any cell of any organism should have a 1:1…
Q: What amino acid sequence is coded for by the mRNA base sequenceCUC-AUU-CCA-UGC-GAC-GUA?
A: The sequence of a protein is notated as a string of letters, according to the order of the amino…
Q: How many amino acids are coded for by the following mRNA: 5…
A: From the DNA, genetic information is transcribed in the form of codons. These codons reside in the…
Q: A scientist while sequencing mrna identifies the following strand…
A: Translation is the process by which polypeptides are synthesized from a mRNA transcript which is…
Q: Codon to be read in the mRNA is 5' GAA 3', what is the amino acid? a. E b. K c.F d.L
A: Dear student answer of your question is given below: Given codon in the mRNA is 5' GAA 3' , It…
Q: if the sequence of bases in the mRNA Codons is 5' - AUCCUACGU - 3' then the sequence of amino acids…
A: In the central dogma of molecular biology, DNA is converted into mRNA by the process of…
Q: Using the genetic code below, decipher the following mRNA sequence.…
A:
Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon,…
A: The central dogma describes the flow of genetic information. It states that genetic information in…
Q: If MRNA has the bases UAU, what is the matching tRNA? O UAU O ATA O TUT O AUA
A: DNA(deoxyribonucleic acid) is the genetic material in all organisms except few viruses. The genetic…
Q: How many amino acids would there be in the protein produced from the following mRNA molecule ?…
A: 1. Stop codons- UAA, UAG and UGA. Codon consists of 3 nucleotides. There are 11 codons, but 10…
Q: Given the mRNA for a protein: 5'–CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid sequence…
A: DNA is the genetic material that gets transcribed into mRNA by an RNA polymerase enzyme. The…
Q: Give the protein synthesized of the given mRNA sequence. No need to explain. Just give the answer.…
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3' , what is the…
A: The genetic code is the set of rules used for translation of the information encoded within genetic…
Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…
A: Amino acids are the organic compounds that contain the amino group (–NH2) and carboxyl group(–COOH)…
Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…
A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…
Q: transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Step by step
Solved in 3 steps
- A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
- An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon, what is the third amino acid of the translated polypeptide?
- An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that would be translated from this mRNA.Given below is the mRNA sequence that encodes the amino acids of a protein. Based on the mRNA sequence predict the amino acid sequence that it encodes. Please list the protein sequence as SINGLE letter amino acids.mRNA: -AUGACACCACUCCACUUAUAGCCCUAA-For each of the following mRNA sequences predict the appropriate protein sequence:a. AUGCGCCCCCAGUGACCACACb. AUGACAUGUGUAAACc. AUGAUAUCUAGACAA
- Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’Given the following mRNA sequence, write the peptide sequence that will result from protein translation. Please indicate the correct directionality.Shown below is the 5' end of an mRNA molecule. What are the first three (N-terminal) amino acids of its protein product? 5'-AUGUGUUGAUGUAUCAGACCUGUC ---