Hi I hope you're doing fine.I need help with these questions, please! thank you! Which components will end up in the final, fully processed mRNA in a eukaryotic cell? Choose all that apply.Intron 1 Intron 2Exon 1DNAExon 33romoterterminatorTranscriptionstarttranscribed: Y TACGATGGG Spromoterexon 1intron 1exon 2intron 2exon 3start codonstop codon

The m RNA that is formed by the process of transcription from DNA is subjected to pre-processing in…

Which components will end up in the final, fully processed mRNA in a eukaryotic cell? Choose all that apply. Intron 1 Intron 2 Eon ) DNA Transcription start transcribed TACGATGGS promoter exon 1 intron 1 exon 2 intron 2 exon 3 start codon stop codon

Which components will end up in the final, fully processed mRNA in a eukaryotic cell? Choose all that apply. Intron 1 Intron 2 Eon ) DNA Transcription start transcribed TACGATGGS promoter exon 1 intron 1 exon 2 intron 2 exon 3 start codon stop codon

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 8TYU: Which of the following is/are typically removed from pre-mRNA during nuclear processing in...

See similar textbooks

Related questions

Q: AAAC G CA G CCG Phe Gly Arg

A: In this image, we are shown the formation of proteins from DNA by following the central dogma of…

Q: Which of the following is not involved in the process of translation? TRNA snRNA All are involved in…

A: Translation can be defined as the process by which RNA is used to make the proteins. The information…

Q: Which of the following step acts before the others in pro ribosome large subunits binds to mRNA TRNA…

A: The translation process completes in three main steps. they are initiation, elongation, and…

Q: Example: Beyonce has brown eyes. Her eyes look brown because her DNA codes for a brown pigment in…

A: The central dogma of molecular biology illustrates the flow of genetic information in a cell. The…

Q: If you remove the terminator from a gene, how will this disrupt the function of RNA polymerase?…

A: Transcription is the process of conversion of all the information from the DNA into mRNA in the cell…

Q: Shown below is a codon in an mRNA. What is the correct sequence of the tRNA anticodon that…

A: The given messenger ribonucleic acid (mRNA) codon 5’-CAG-3’ codes for the amino acid glutamine.…

Q: Which category of RNA carries amino acids for the process of translation? rRNA snRNA mRNA tRNA

A: Translation is the process of Synthesis of proteins from mrna. This process takes place in cytoplasm…

Q: After transcription, how is mRNA processed in eukaryotes? (Choose all that apply) 3' polyA tail is…

A: TRANSCRIPTION It is the formation of mRNA from DNA. The mRNA formed has to undergo various…

Q: Which RNA molecule(s) are modified at the 5' and 3'ends in eukaryotes? 1. 2. 3. MRNA tRNA FRNA tRNA…

A: Disclaimer: Since you have asked multiple questions, we will solve the first question for you. If…

Q: RNA Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 Intron 3 Exon 4

A: Eukaryotic primary transcripts are split. That is, they are composed of coding sequences for…

Q: What is the difference between transcription and translation? Transcription is the conversion from…

A: The genetic material is stored in the DNA of the nucleus of the cell.

Q: DNA C A T G C U MRNA U UG ERNA ionine Amino Acids is synthesized in translation or transcription?…

A: Transcription is the synthesis of m RNA from a DNA template. The translation is the synthesis of a…

Q: Which of the following statements about the spliceosome is false? a. A spliceosome splices pre-mRNA…

A: For RNA maturation there are about 40 different types of proteins and small RNAs that are called sn…

Q: Which of the following is NOT found on a mature eukaryotic mRNA molecule? (Choose all that apply)…

Q: mRNA binds to a ribosome. Transcription completes. mRNA leaves the nucleus. tRNA attaches to the…

A: DNA translation is the term used to portray the course of protein synthesis by ribosomes in the…

Q: Which of these pieces of a gene will ultimately be read by the ribosome to produce a protein?…

A: Pieces of genes introns and exons are actually nucleotide sequence within a gene. There is an…

Q: Why is the position of the first AUG after the ribosome-binding site critical?

A: Introduction The process of transcribing the mRNA into protein is called Translation. There are 3…

Q: Part A Which of the following processes is represented in the figure below? 3' AAG UGA RF1 RF2 O…

A: Thank you for the question Answer :- The given picture shows translation termination Explanation :-…

Q: Which one of the following sequences is most likely to cause a ribosome to release a mRNA strand?…

A: A ribosome is an inter - cellular structure made up of both RNA and protein that provides as the…

Q: What will happen if RNA polymerase fails to attach to the promoter? O Translation Will begin early.…

A: Introduction "Transcription Is The Process Of Formation Of An RNA Molecule From DNA". One Of The…

Q: How many copies of a protein can be produced from a single mRNA transcript? Many because copies of…

A: Transcription is the process by which an mRNA is synthesized from DNA which then undergoes the…

Q: Choose the option that goes with the blank. The parentheses after the blank are the choices.…

A: In the process of synthesis of proteins from DNA, the information in DNA is used for the synthesis…

Q: Which of the following is unique to eukaryotic mRNA synthesis? O Coupled transcription-translation O…

A: The correct option is Removal of Introns. Explanation: Before it can be translated, eukaryotic…

Q: What type of RNA corresponds to the statement? Choices: mRNA, tRNA, Prokaryotic, rRNA, Eukaryotic,…

A: RNA is a polymer of nucleotides attached together via phosphodiester bonds. RNA is generally…

Q: What type of RNA corresponds to the statement? Prokaryotic Eukaryotic FRNA MRNA TRNA hnRNA RNA FRNA…

A: RNA or Ribonucleic acid is one among different biomolecules. They are also composed of nucleotides;…

Q: Which of the following is the first step of translation in a eukaryotic cell? a RNA containing…

A: Translation is the process of protein synthesis which is done by ribosomes.

Q: Which of the following statements is true of eukaryotic transcription? Exons are spliced out from…

A: Introduction A genome is consisting of transcriptionally active genes. These genes form RNA…

Q: intervening sequence?

A: introduction Intervening sequence : Part of a quality that is at first interpreted from the DNA…

Q: Which level of gene regulation is involved when more polypeptides are synthesized from a given mRNA…

A: Transcription: It is a process of synthesis of mRNA transcript from DNA template by the enzyme RNA…

Q: Which of the following step is NOT involved in eukaryotic MRNA synthesis? O Elongation O…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy-ribose nucleic acid in which…

Q: Match the terms with the best description.____ genetic message a. protein-coding…

A: A gene is a specific sequence of nucleotides in DNA or RNA that is usually found on a chromosome and…

Q: All of the following are directly involved in translation excepta) promoter. b) ribosome.…

A: Introduction: The chemical nature of genes, such as genetic information encoding, gene expression,…

Q: 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA.…

A: The double-helical structure of DNA was transcribed into mRNA molecules and these mRNA molecules are…

Q: B- TRANSCRIPTION 1. Use the DNA code provided to copy an mRNA message. (DNA) a. TAC GGA CAT (DNA) b.…

A: The central dogma explains that the information from the DNA will be passed in a sequence fashion…

Q: The codon on the ________ matches with the anticodon on the ________ to direct the addition of the…

A: Codon are the triple of a base pair.

Q: Which would not be found on an mRNA molecule? Group of answer choices 3' untranslated region 5'…

A: Transcription is responsible for producing mRNA from the template strand of DNA.

Q: An R loop experiment was performed on two different mRNA's. The first showed one R loop, while the…

A: Eukaryotic mRNA is transcribed post-transcriptionally to form mature mRNA. The post-transcriptional…

Q: Which type of biological molocule is being made during this process? Incoming tRNA Bound NA to Amino…

A: The figure is showing the process of translation. Translation is the process of formation of a…

Q: In RNA, ___________ pairs with adenine. A.Group of answer choices cytosine guanine thymine…

A: RNA (ribonucleic acid) is a nucleic acid which consists of repeating units of ribonucleotides. A…

Q: Which of the following is NOT a protein that aids the ribosome during translation? Question 28…

A: Translation is a process through which polypeptide chains or proteins are synthesized from mRNA with…

Q: If an mRNA nucleotide is synthesized from DNA, how do you identify the: 5’end; 3’ UTR;…

A: The promoter sequence serves as a site for binding of RNA (ribonucleic acid) polymerase. It is…

Q: what is the first event to take place in translation in eukaryotic cell? a. An clongation of the…

A: Translation is the process which is responsible for synthesis of protein from the mRNA.

Q: Which components will end up in the final, fully processed MRNA in a eukaryotic cell? Choose all…

A: Post-transcriptional modifications are chemical modifications of the primary RNA transcript to…

Q: Match the steps of transcription and translation to the location they take place within a eukaryotic…

A: Transcription is the process of making an RNA copy of a gene sequence. This copy is called mRNA. The…

Q: Which of these features is found in eukaryotes but not bacteria?a. polygene mRNAs b. introns c. stop…

A: Living organisms are primarily classified as prokaryotes and eukaryotes. Prokaryotic organisms like…

Q: Below are the general steps of protein synthesis. What is the correct sequence of protein synthesis?…

A: The process of synthesis of proteins is called translation. Proteins are synthesised in a cell in…

Q: Choose the option that goes with the blank. The parentheses after the blank are the choices.…

A: Codon are sequence of 3 Nucleotide bases on mRNA that code for specific amino-acid. Anticodon are…

Q: 8. Codons are sequences that correspond to specific amino acids or signals during protein…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Which of the following would not be found in a mature mRNA in a eukaryotic cell? A Star Codon B…

A: Select the component that is not present in mature mRNA of eukaryotic cells. The given options areA.…

Question

Hi I hope you're doing fine.

I need help with these questions, please!

thank you!

Which components will end up in the final, fully processed mRNA in a eukaryotic cell? Choose all that apply.
Intron 1 Intron 2
Exon 1
DNA
Exon 3
3romoter
terminator
Transcription
start
transcribed: Y TACGATGGG S
promoter
exon 1
intron 1
exon 2
intron 2
exon 3
start codon
stop codon

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following is/are not found in a bacterial mRNA molecule? (a) stop codon (b) upstream leader sequences (c) downstream trailing sequences (d) start codon (e) promoter sequences
A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the preceding
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
A ribosome binds to the following mRNA at the site indicatedby the dark box. At which codon will translation begin?5′ ■ GCCGGAAUGCUGCUGGCa) GCC b) GGCc) AUG d) AAU
The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’
An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.
An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.
An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that would be translated from this mRNA.
What is the last codon in this mRNA sequence? AUGCCAUGG
Which of these features is found in eukaryotes but not bacteria?a. polygene mRNAs b. introns c. stop codon d. AUG codon