4. Complete the table below: RNA DNA Strand Sugar residue Nitrogenous bases Main Function
Q: An enzyme catalyzes a reaction with a Km of 7.50 mM and a Vmax of 2.90 mM · s-!. Calculate the…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Discuss about enzymes: function, definition, and examples.
A: At high temperatures, most of the enzymes denature and unfold similarly low temperatures…
Q: Directionality of Polynucleotide chains originates at the ____ end, and terminates at the _____…
A:
Q: Based on the figure and the explanation in the textbook, what are the random chances that the…
A: Denaturation is the process by which proteins lose their native conformation. Ribonuclease A has 124…
Q: 2 Two version of the same enzyme were isolated, a wild type and a mutant differing at a single amino…
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…
Q: Proteins are compounds composed of many _________ linked together
A: The protein which is most important constituent for every living organisms. The term protein firstly…
Q: Which of the following is/are incorrect? - All proteins are polymeric - Not all nucleic acids are…
A: A biomolecule, also called a biological molecule, is a chemical compound found in living organisms.…
Q: A 100 mL solution of 0.1 M amino acid (AA) at pH 1.0 was titrated with NaOH solution. The pH was…
A: As you have posted multiple questions, according to Bartleby guidelines, we are answering the…
Q: The first loss of carbon in the metabolism of glucose takes place as CO2, in the formation of…
A: Glucose metabolism occurs in three stages. They are 1) Glycolysis 2) TCA cycle 3) Oxidative…
Q: On an SDS-gel, If the distance traveled by the bromophenol blue dye is 7 cm, and the distance…
A: Given values: Distance traveled by the dye front = 7 cm Distance traveled by the protein = 2.8 cm
Q: Among the simplest_ , those called_, are glucose (an_) and _(a _).
A: Glucose is simple sugar which is present in body having molecular formula C6H12O6.Glucose is…
Q: The molecules of a fatty acid (for example, fit closer together than the molecules of a fatty acid…
A: Fatty acids are composed of a long hydrocarbon chain attached to a carboxylic acid group. Fatty…
Q: Which of the following best describes an amino acid that can be used to synthesize proteins?
A: Monoprotic acids - are the acids that donates only one proton (H atom) per molecule of acid to an…
Q: 10. The degree of unsaturation of lipid can be measured as A. saponification number B. iodine number…
A: Saturated fats are the fatty acids in which the hydrocarbon chain with a carboxyl group contains…
Q: Q1: Explain the effect of pH value on the amino acid ionization. Q2: Describe two reactions for…
A: Amino acids and their ionization: Amino acids are the basic building blocks of proteins, they are…
Q: What is/are the end product(s) of protein digestion?
A: Disclaimer: “Since you have asked multiple question, we will solve the first question for you. If…
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Allosteric enzymes have binding sites other than active sites for the regulator molecules that…
Q: Lys and Arg Glu and Lys Pro and Asp Among these amino acid combinations listed above, only the…
A: Proteins are composed of a linear chain of amino acids attached together via peptide bonds. All…
Q: Using a semi-permeable membrane, dialysis allows the removal of salt ions prior to chromatography.…
A: Dialysis is a separation process that uses selective and passive diffusion via a semi-permeable…
Q: Which of the following condition is NOT associated with riboflavin deficiency? * (Please choose one…
A: Riboflavin is a water soluble vitamin. It is also called as B2 vitamin. Foods like pork, eggs,…
Q: A protein has a tertiary structure formed by interactions between the side chains of the following…
A: Two protein interacts with each other using side chain of interaction. Depending upon interacting…
Q: Match the following: choices: transcription factor
A: Transcription is the process of synthesizing RNA from genetic information stored in DNA. There are…
Q: Explained how metal ions help in enzyme action. Cite three vitamins that have antioxidant activities
A: The process of translation takes place in the cytoplasm which converts mRNA to…
Q: What is the predominant attractive force that stabilizes the formation of secondary structure in…
A: The levels of structural organization of a protein are its primary structure, secondary structure,…
Q: What are the different classes of nucleic acids?
A: Nucleic acids are chemical substances that exist naturally and act as the principal…
Q: 1) What is the chemical group at the end of the R groups of basic amino acids that makes them…
A: There are twenty standard amino acids that make up all of the proteins. The twenty standard amino…
Q: Given a Glucuromic acid omd glutathione for A) are impartantto PhaseI xemabistic melabolism B)…
A: Glucuronic acid is a sugar carboxylic acid which is generated by the oxidation of the C-6 carbon of…
Q: We have described an ATP synthase complex with an Fo complex of 9 c-subunits. Consider if the F0…
A: In order to solve this problem, first we need to identify the reaction catalyzed by the enzyme…
Q: All are factors or subunits contained within the E. coli RNA polymerase holoenzyme in prokaryotic…
A: Transcription is the process of synthesizing RNA from genetic information stored in DNA. There are…
Q: Which of the following statements regarding size exclusion chromatography is false? During…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: Test Results + or -? Points awarded Code Glu – acidic end products yellow ______ _____+ Glu – gas…
A: Introduction: Microbial metabolic processes are complex but still, it permits the microbiologist to…
Q: 1. Draw the complementary DNA strand for the given: 5'-A-T-C-C-G-A-A-T-T-G-3' Answer: 2. Draw the…
A: In a complementary base pairing, purine pairs with a pyrimidine. A always pairs with T, similarly C…
Q: A polypeptide with a net positive charge at physiologic pH (~7.4) most likely contains amino acids…
A: are non-polar. Doesn't contribute to charge o the polypeptide.
Q: Determination of the amino acid composition requires the following steps, EXCEPT O Separation of…
A: Introduction: Amino acid is a compound that contains an amino and a carboxyl group with a side chain…
Q: Ribonuclease A cannot catalyze the hydrolysis of DNA. which of the following statements explains…
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…
Q: Assessing the efficacy of glucosamine and chondroitin sulfate for arthritis pain Treatment with…
A: Many patients with arthritis, particularly osteoarthritis, utilise vitamins in their diet to relieve…
Q: From the diagram to the right of the trp repressor in its (i) approximate binding relationship to a…
A: Given Figure shown trp repressor protein bond to DNA double strand. Protein is mainly comprised of…
Q: Which of the following is INCORRECTLY paired? O Isoelectric focusing : Charge O Gel filtration…
A: 1. Isoelectric focusing IEF is an electrophoretic method for separating proteins based on their…
Q: 4. The sequence of a peptide A formed by 16 amino acids was determined using a combination of…
A: Proteins are chain of amino acids linked by peptide bond with release of a water molecule. Alpha…
Q: Under what pH conditions can a protein not bind to the beads in a column? pH = -pKa pH =…
A: Proteins are composed of amino acids. There are a total of twenty standard amino acids that make up…
Q: TRUE OR FALSE: 1. The 35S precursor is the precursor RNA transcript for all ribosomal RNAs except…
A: Ribosomal RNA is the component of Ribosomes which is essential for translation and forcing tRNA and…
Q: 1. To investigate the physical properties and uses of some common aldehydes and ketones. 2. To…
A: Carbohydrates are composed of carbon, oxygen, and hydrogen which are connected by the…
Q: e overall outcome of the light reaction
A: here we have been asked what is the overall outcome of light reaction that occurs during…
Q: For each of the tripeptide: Tyrosylisoleucylleucine Methionylcysteinylisoleucine 1. Draw the…
A: An amino group and an acid group-containing organic molecules are called Amino acids.…
Q: Transcription of a typical gene encoding a polypeptide in eukaryotes involves all of the following…
A: In eukaryotes, the genomic DNA is present in the nucleus. The process of transcription in the case…
Q: Explain the enzymes.
A: An enzyme is a biocatalyst that increases the rate of chemical reaction without itself being changed…
Q: - TRUE about the peptide bond:
A: With the loss of a water molecule, a covalent link is formed between the -amino group of one amino…
Q: What assay could be used to test the function of a protein in the glycoside hydrolase family?
A: Glycoside hydrolases are enzymes that catalyze the hydrolysis of the glycosidic linkage of…
Q: All the dehydrogenases of glycolysis and the citric acid cycle use NAD+ (E°' for NAD+/NADH is -0.32…
A: NADH/FADH2 are also known as reducing equivalents. These reducing equivalents are produced in the…
Q: How does the summary equation for metabolism relate photosynthesis and cellular respiration?…
A: Carbohydrates are a major forms of energy for both animals and plants. While plants have the ability…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. FluxomeDefine the following terms:a. repliconb. Okazaki fragmentc. ter regiond. tus proteine. preinitiation complexDefine the following terms:a. DNAb. RNAc. double helixd. genomee. transcription
- Below is a short nucleotide sequence from a gene. Use the Internet(e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what genethis sequence is from. Also, determine the species in which thisgene sequence is found. 5’–GGGCGCAATTACTTAACGCCTCGATTATCTTCTTGC GCCACTGATCATTA–3’Complete the table below: DNA DNA Complimentary Strand mRNA sequence tRNA sequence Amino acid code A T G A A A G T C A T T T A GDNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCG GCT CTC CCA GTT GAA CT Original Amino acid: Mutated Amino Acid:
- On the gel diagram below, show how you believe these fragments will sort out during electrophoresis. Label each fragment with its correct number of base pairs. (8 fragments)In the given segment, illustrate and indicate the direction of synthesis of: a.) a 5-nucleotide RNA primer b.) a 2-nucleotide Okazaki fragmentDNA Sequence: TAC TCC GGC TCT CCC AGT TGA ACT Mutated Sequence: TAC TCC GGC TCT CCC ACT TGA ACT Original Amino acid: Mutated Amino Acid:
- Define the following terms:a. DNA typingb. short tandem repeatsc. DNA profiled. ribozymee. noncoding RNADefine the following terms:a. codonb. anticodonc. genetic coded. open reading framee. codon usage biasTranslate and transcribe the following DNA molecules DNA:AATACGGGGGCGTAACCACTA mRNA: amino acids: