Transcription of a typical gene encoding a polypeptide in eukaryotes involves all of the following EXCEPT:transcription of DNA corresponding to both introns and exons.transcription of the DNA corresponding to the gene of the polypeptide which may include UTRS(c) RNA synthesis by RNA polymerase II.the splicing together of a number of exons in the DNA prior to transcription.

In eukaryotes, the genomic DNA is present in the nucleus. The process of transcription in the case…

Answered: Transcription of a typical gene…

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the preceding
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
. Eucaryotic processing of hnRNA into mature mRNA includes all of the following steps except: ribosome attachment to the Shine-Dalgarno sequence 5’-addition of a 7-methylguanosine cap 3’-addition of a polyadenylated tail splicing together of exons excision of introns
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
The sigma factor protein's role in transcription in E. coli includes which of the following? None of the answer options are correct. plays a role in transcription termination forms part of the core enzyme required for transcription initiation helps the siRNA to bind to the promoter All of the answer options are correct. contributes to the proof-reading activity of RNA polymerase And The role of tRNA is to serve as an intermediate in the decoding of genes. serve as general translational components of the ribosome. facilitate protein trafficking in protein secretion. facilitate splicing of pre-messenger RNAs. act as vehicles bringing amino acids to the site of protein synthesis. None of the answer choices are correct.
Many genes in both bacteria and eukaryotes contain numerous sequences that can cause pauses in or premature termination of transcription. Nevertheless, the transcription of these genes within a cell normally produces multiple RNA molecules thousands of nucleotides long without pausing or premature termination. However, when a single round of transcription of these genes takes place in a test tube, RNA synthesis is frequently interrupted by pauses and premature terminations, which reduce the rate at which transcription takes place and frequently shorten the lengths of the mRNA molecules produced. Most pauses and premature terminations occur when RNA polymerase temporarily backtracks (i.e., backs up) for one or two nucleotides along the DNA. Experimental findings have demonstrated that most pauses and premature terminations disappear if several RNA polymerases are simultaneously transcribing the DNA molecule. Propose an explanation for this observation of faster transcription and longer…
Transcription in eukaryotes requires which of the following in addition to RNA polymerase? Choose all that apply A) ribsomes and tRNAs B) start and stop codons C) several transcription factors D) DNA nucleotides E) Aminoacyl-tRNA synthetase F) RNA nucleotides .
Bacteria use the same stop codons as eukaryotes. However, bacterial transcription is also terminated in places where the mRNA folds back on itself to form a hairpin-looped structure like the one shown below. How do you think that this structure stops transcription?
EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in prokaryotic translation. The sigma subunit of RNA polymerase is replaced by NusA to recognise the promoter region of a gene. The -10 and -35 sequences in E. coli DNA are referred to as untranslated region. In human, translation begins before transcription of an mRNA completes. this statement true or false.
The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides long, but the mature mRNA that is translated on the ribosome is 1872 nucleotides long. This size difference occurs primarily as a result of: capping cleavage of polycistronic mRNA removal of poly A tails reverse transcription splicing
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Mark the point at which transcription will terminate

SEE MORE QUESTIONS

Recommended textbooks for you

Biology Today and Tomorrow without Physiology (Mi…

Biology

ISBN:

9781305117396

Author:

Cecie Starr, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biology Today and Tomorrow without Physiology (Mi…

Biology

ISBN:

9781305117396

Author:

Cecie Starr, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biology (MindTap Course List)

Biology

ISBN:

9781337392938

Author:

Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS