Consider a portion of a gene in a cell with the sequence TTTTT. Which of the following bases would you find in the complementary RNA strand, and where in the (eukaryotic) cell would this RNA be synthesized? A) A-A-A-A-A; ribosome B) U-U-U-U-U; ribosome C) A-A-A-A-A; nucleus D) U-U-U-U-U; nucleus

Consider a portion of a gene in a cell with the sequence TTTTT. Which of the following bases would you find in the complementary RNA strand, and where in the (eukaryotic) cell would this RNA be synthesized? A) A-A-A-A-A; ribosome B) U-U-U-U-U; ribosome C) A-A-A-A-A; nucleus D) U-U-U-U-U; nucleus

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 20QP: If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it...

See similar textbooks

Related questions

Q: The two-dimensional structures of mRNA, tRNA, and rRNA are shown in the diagrams. Which of the…

A: The primary function of rRNA is the synthesis of proteins by binding to mRNA and tRNA to ensure the…

Q: The nucleoside consists of a D-deoxyribose and a cytosine base is called ______. A. cytidine B.…

A: Nucleoside term was used in 1909 to denote compounds from the yeast nucleic acid hydrolysates.Now a…

Q: Explain the process translation. A complete answer will include the words below tRNA, amino acid,…

A: The translation is the process of amino acid change of protein synthesis from the mRNA sequence. The…

Q: In cells, proteins are synthesized from a gene sequence via the process of transcription and…

A: In prokaryotes cell organelles are absent. The genomic DNA of prokaryotes is found in the cytoplasm.…

Q: If a protein is created via the translation of 705 nucleotides, including a start and a stop codon,…

A: Central dogma is the process in which RNA is produced from the DNA (transcription) and amino acid…

Q: Do any strands of nucleic acid exist in nature in which part of the strand is DNA and another part…

A: DNA RNA hybrid is a formed when one strand is DNA and another strand is RNA. In DNA Thymine is…

Q: What is most closely associated with the cell organelle in the process represented in the diagram ?…

A: Cell is the smallest structural and, functional unit of life. It is simple machinery that houses all…

Q: The nearly universal genetic code consists of how many codons?

A: Genes are the unit of heredity and they are made up of triplet genetic codons. These codons are…

Q: Why are there nucleotides (A, T, G, and C) in the master mix? What are the other components of the…

A: PCR is a technique that results in exponential amplification of a selected region of a DNA molecule…

Q: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

A: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

Q: The compound known as nitrous acid is a reactive chemical that replaces amino groups (−− NH2) with…

A: The given compound nitrous acid substitutes the cytosine(C) with uracil (U) and adenine (A) with…

Q: translate the following sequence of messenger RNA nucleotides in a sequence of amino acids forming…

A: Since you have posted a question with multi-sub parts, we will solve the first three sub-parts for…

Q: Suppose you are provided with a sequence of nucleotides. How would you determine if the sequence is…

A: DNA and RNA are the main components that carry genetic information from one generation to another…

Q: If a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence…

A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…

Q: How many bases make up a codon?

A: The flow of genetic information from DNA to mRNA to proteins is central dogma where the process of…

Q: If the DNA template strand was TACCTAGAT, what would the mRNA codons be?

A: This process is called transcription i.e synthesis of m RNA from DNA. The DNA strand that forms m…

Q: You are a molecular biologist studying a defective human protein that is known to be a cause of a…

A: It is given in the question that the protein from the cancer patient differs in almost every amino…

Q: Protein synthesis in eukaryotes is similar to the process in prokaryotes in that both eukaryotes and…

A: According to the question, we have to mention that protein synthesis in eukaryotes is similar to the…

Q: The process of translation involves three distinct phases: initiation, elongation, and termination.…

A: Translation is the process by which a protein is synthesized from the information contained in a…

Q: Nucleic acids involved in protein synthesis include DNA sense strand DNA anti-sense strand mRNA…

A: Nucleic acids are composed of phosphoric acids, sugars, and mixtures of organic bases like purines…

Q: The following DNA sequence corresponds to the complete coding sequence of a gene that codes for a…

A: mRNA codons are used to determine sequence in the original DNA and anticodons of tRNA. tRNA…

Q: Here is our DNA sequence: T-A-C-A-T-G-T-T-T-A-G-G-T-C-C-A-C-C-C-G-T-G-G-G-A-C-T Write the RNA…

A: Introduction The process by which the genome's DNA is copied in cells is known as DNA replication.…

Q: Which of the following statements is true regarding the formylmethionine that serves as the first…

A: Introduction Protein synthesis:- The process by which amino acids are linearly arranged into…

Q: What is the structure and components of the nucleosome? Briefly explain with your words.

A: Nucleosomes are particles made up of histone proteins around which DNA is wrapped.

Q: Based on the work presented in Boch et al., 2009 Science, choose all of the DNA sequences that can…

A: Many bacteria's pathogenicity is dependent on the injection of effector proteins into eukaryotic…

Q: Which of the following statements regarding the genetic code is false? The genetic code is…

A: Genetic code is used for ways in which the four bases of DNA- - the A, C, G, and Ts- - are hung…

Q: Which of the following are stages of translation? Select all that apply. ---A tRNA binds to…

A: The translation is a process, in which tRNA (Transfer Ribonucleic acid), mRNA (messenger RNA),…

Q: When glycoproteins are synthesized in the cell, at what stage of the polymerization of the protein…

A: Proteins with covalently linked sugar residues are known as glycoproteins. Sugars' hydrophilic and…

Q: Which of the following are encoded in the terminating codon in protein synthesis? a.…

A: The process of formation of protein molecules is known as protein synthesis. The process of protein…

Q: The genetic code uses combinations of 3 RNA bases as letters, each triplet specifies only one amino…

A: A genetic code is a triplet code of nucleotides that codes for a specific amino acid. It is also…

Q: Which of the following RNA molecules is responsible for carrying the code that will be read at the…

A: Proteins ar polymers of amino acids. Major functions embrace acting as enzymes, receptors, transport…

Q: What would the peptide sequence be like after translation?

A: Translation is the process by which polypeptide or protein is produced from the mRNA by the help of…

Q: specific base pairing essential to the processes of transcription and translation?

A: Transcription is the process by which an RNA copy of a gene sequence is created. This copy, known as…

Q: When does a peptide bond form during translation? 1) When the P-site and E-site are occupied by TRNA…

A: mRNA is translated to form protein through the process translation with the help of ribosome, tRNA.…

Q: In eukaryotic cells, the length of the transcribed RNA is almost equal to the corresponding DNA…

A: Eukaryotic cells are huge and sophisticated creatures having a nucleus encased within the nuclear…

Q: Consider the multiple sequence alignment for a polypeptide below. Which of the eight amino acid…

A: Biomolecules such as proteins play a very important role in catalyzing biochemical reactions. They…

Q: What is the meaning of translation in molecular biology?

A: The literal meaning of translation is conversion of data from one language to another. This is the…

Q: Translate the RNA codons using the given genetic code 5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'

A: Translation: Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: If methionine is the first amino acid incorporated into a heptapeptide, what is the sequenc of the…

A: Each group of three bases in a mRNA constitutes a codon. Each codon specifies an amino acid.

Q: What is a bacterial nucleoid? With regard to cellular membranes,what is the difference between a…

A: Step 1 Bacteria are moneran procaryotic microorganisms, are unicellular and ubiquitous in nature. An…

Q: What structural feature allows DNA to store information?

A: Deoxyribonucleic acid (DNA) is regarded as the storehouse of genetic information, as all hereditary…

Q: What is cDNA?

A: Deoxyribonucleic acid (DNA) is a double stranded helical genetic material containing thousands of…

Q: Give the name of the base, the ribonucleoside or deoxyribonucleoside, and the ribonucleoside…

A: The RNA and DNA are the nucleic acids present in the cells . Both RNA and DNA consists of…

Q: What is the name of the process by which amino acids arelinked together in the correct order based…

A: Translation is a process that has “decoding” a messenger RNA (mRNA) that is used to build a…

Q: Which amino acid is at the beginning of every eukaryotic protein and why?

A: The genetic information is transferred from DNA to RNA and from RNA to protein. This flow of genetic…

Q: What are the key properties of the genetic code? Given that the genomes of all organisms are made up…

A: Genetic code is the sequence of nucleotides in DNA or RNA which determines the sequence of amino…

Q: A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following…

A: When referring to DNA transcription, the coding strand is the DNA strand whose base sequence…

Q: If there are 64 codons, how can there be fewer than 64 tRNA molecules?

A: An adapter molecule made of RNA, generally 76 to 90 nucleotides in length (in eukaryotes), that acts…

Question

Consider a portion of a gene in a cell with the sequence TTTTT. Which of the following bases would you find in the complementary RNA strand, and where in the (eukaryotic) cell would this RNA be synthesized?

A) A-A-A-A-A; ribosome

B) U-U-U-U-U; ribosome

C) A-A-A-A-A; nucleus

D) U-U-U-U-U; nucleus

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Answer

VIEW

Explanation:-

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Which of the molecules of RNA is the most likely to fold into a specific structure as a result of intramolecular (within itself) base-pairing? Explain. 5′-CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG-3′ 5′-UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG-3′ 5′-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′ 5′-GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGCAAGG-3′
The process of translation involves three distinct phases: initiation, elongation, and termination. Which of the following is an accurate statement of a molecular event that occurs during one of the phases? A. All phases of translation require the energy of ATP to fuel molecular processes. B. The first components to assemble in initiation are the large ribosomal subunit, mRNA, and the initiator tRNA molecule. C. A peptide bond forms between the new amino acid and the amino acid at the C-terminus of the growing polypeptide chain. D. Amino acids are added to the polypeptide chain that sits in the A site of the translation initiation complex.
If the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became A-C-T-G-G-C-C-T-A, what effect would the mutation have on the sequence of the protein produced?
What is the consensus sequence of the following six DNA sequences?GGCATTGACTGCCATTGTCACGCATAGTCAGGAAATGGGAGGCTTTGTCAGGCATAGTCA
Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'
In cells, proteins are synthesized from a gene sequence via the process of transcription and translation. Which of the following complementary base pairings would you observe during the synthesis (the making) of a prokaryotic protein? [I am looking for the complementary base pairing(s) you would see as you go from a gene to a protein. Note that it is prokarryotic protein and not eukaryotic protein]. DNA with mRNA mRNA with tRNA mRNA with rRNA rRNA with tRNA A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1, 2, 3 and 4 are correct
From the following DNA strand: AAGCTAGGATTGCC How many codons would be present?
Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can hybridize one of the strands of that gene to the mRNA for that gene by allowing the strands to hydrogen bond. Why is it sometimes claimed that alternative splicing of exons from a single gene results in a set of proteins of related function?
UAA is a stop codon. Why does the UAA sequence in the segment of mRNA 5′-G-C-A-U-G-G-A-C-C-C-C-G-U-U-A-U-U-A-A-A-C-A-C-3′not cause protein synthesis to stop?
Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?
Why are there nucleotides (A, T, G, and C) in the master mix? What are the other components of the master mix, and what are their functions?
Which of the following are stages of translation? Select all that apply. ---A tRNA binds to the second codon and its carried amino acid forms a peptide bond with methionine. ---When the ribosome reaches a stop codon, its subunits detach, and the mRNA and new polypeptide are released. ---As the ribosome moves from codon to codon, amino acids brought by successive tRNAs to the ribosome form a growing polypeptide. ---The binding of a tRNA to the third codon causes the ribosome to release the first tRNA and move to the next codon. ---Ribosomal subunits and a tRNA carrying methionine converge on the start codon of an mRNA.