
Database System Concepts
7th Edition
ISBN: 9780078022159
Author: Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Construct a solution
should contain:
- a defining diagram
- a pseudocode algorithm
- a desk check of the algorithm
- Design an algorithm that will prompt an operator for a student’s serial number and the student’s exam score out of 100. Your program is then to match the exam score to a letter grade and print the grade to the screen. Calculate the letter grade as follows:
Exam Score | Assigned Grade |
90 and above | A |
80 - 89 | B |
70 - 79 | C |
60 - 69 | D |
below 60 | F |
Expert Solution

arrow_forward
Step 1
Answers:-
Here is a sample algorithm in Python that prompts an operator for a student's serial number and exam score and then calculates and prints the corresponding letter grade:
Step by stepSolved in 5 steps with 1 images

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- Please help in guiding me in the necessary steps i should take when tackling this assignment, there is a main.cpp given Objective: The main objective of this assignment is to assess students’ ability to apply the stepwise refinement process to develop a new algorithm and carry that through to the implementation of the program. Implementation must follow the top-down design approach, where the solution starts by describing the general functionality of a game. Next, more details are provided in successive steps to refine the implementation. Problem Description: Assume you are hired by a game developing company to write a new computer game for kids. This company has decided to create a version of tricky triangles with a few different rules hoping that this new game will be more entertaining. If you are unfamiliar with the original game of tricky triangle, please learn how to play. This modified version of tricky triangles that you required to create is very much like the original game.…arrow_forwardCustomized step counter Learning Objectives In this lab, you will Create a function to match the specifications Use floating-point value division Instructions A pedometer treats walking 2,000 steps as walking 1 mile. It assumes that one step is a bit over 18 inches (1 mile = 36630 inches, so the pedometers assume that one step should be 18.315 inches). Let's customize this calculation to account for the size of our stride. Write a program whose input is the number of steps and the length of the step in inches, and whose output is the miles walked. Output each floating-point value with two digits after the decimal point, which can be achieved as follows: print(f'{your_value:.2f}') Ex: If the input is: 5345 18.315 the output is: You walked 5345 steps which are about 2.67 miles. Your program must define and call the following function. The function should return the number of miles walked.def steps_to_miles(user_steps, step_length) # Define your function here if __name__…arrow_forwardAlgorithm Design and Analysis 1. Body wanted to go on a tour but he was confused about what items to bring. In order to show his wealth, he decided to bring the item with the highest value. But the suitcase only holds 5KG left. Body asks your help to choose from the list below. Name Price Weight (kg) A 460 4 B 220 1.5 C 360 3 D 220 1 E 400 3.5 F 480 2.5 G 150 2 2. Use KMP to complete the following string matching! T= ACGTACGTGACGTGTACGATATCACGTACT P= ACGTACTarrow_forward
- COMPUTER FUNDAMENTALS AND PROGRAMMING 2 USING JAVA CODES Input the temperature, and determine whether or not it is within the typical range for that temperature.arrow_forwardJAVA algorithm ur pseudo-code ,, top-down, stepwise refinement. Write a Java program.. Baker Co pays commision. Salesppl get $200 a wk nd 9% of their gross sales per wk. You’ve been supplied with a list of the items sold by each salesperson. The values of these items are in pic, app inputs one 1 sale ladys items sold for last wk and calculates and shows her earnings. She can sell any amntarrow_forwardLesson in Computer fundamentals of Pogramming please help, thanks.arrow_forward
- Problem Statement The barcode used by the U.S. Postal System to route mail is defined as follows: Each decimal digit in the ZIP code is encoded using a sequence of three half-height and two full-height bars. The barcode starts and ends with a full-height bar (the guard rail) and includes a checksum digit (after the five-digit ZIP code or ZIP + 4), computed by summing up the original digits modulo 10. Define the following functions: Draw a half-height or full-height bar on stddraw. Given a digit, draw its sequence of bars. Compute the checksum digit. Also define global code that read in a five- (or nine-) digit ZIP code as the command-line argument and draws the corresponding postal barcode.arrow_forwardA fractal pattern has the sequence {1, 10, 100, 1000, …}. The recursive formula is _________.arrow_forwardCOMPUTER FUNDAMENTALS AND PROGRAMMING 2 USING JAVA CODES Input the temperature, and determine whether or not it is within the typical range for that temperature.arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Database System ConceptsComputer ScienceISBN:9780078022159Author:Abraham Silberschatz Professor, Henry F. Korth, S. SudarshanPublisher:McGraw-Hill EducationStarting Out with Python (4th Edition)Computer ScienceISBN:9780134444321Author:Tony GaddisPublisher:PEARSONDigital Fundamentals (11th Edition)Computer ScienceISBN:9780132737968Author:Thomas L. FloydPublisher:PEARSON
- C How to Program (8th Edition)Computer ScienceISBN:9780133976892Author:Paul J. Deitel, Harvey DeitelPublisher:PEARSONDatabase Systems: Design, Implementation, & Manag...Computer ScienceISBN:9781337627900Author:Carlos Coronel, Steven MorrisPublisher:Cengage LearningProgrammable Logic ControllersComputer ScienceISBN:9780073373843Author:Frank D. PetruzellaPublisher:McGraw-Hill Education

Database System Concepts
Computer Science
ISBN:9780078022159
Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher:McGraw-Hill Education

Starting Out with Python (4th Edition)
Computer Science
ISBN:9780134444321
Author:Tony Gaddis
Publisher:PEARSON

Digital Fundamentals (11th Edition)
Computer Science
ISBN:9780132737968
Author:Thomas L. Floyd
Publisher:PEARSON

C How to Program (8th Edition)
Computer Science
ISBN:9780133976892
Author:Paul J. Deitel, Harvey Deitel
Publisher:PEARSON

Database Systems: Design, Implementation, & Manag...
Computer Science
ISBN:9781337627900
Author:Carlos Coronel, Steven Morris
Publisher:Cengage Learning

Programmable Logic Controllers
Computer Science
ISBN:9780073373843
Author:Frank D. Petruzella
Publisher:McGraw-Hill Education