What would fit best for definitions? Nucleic acid molecule that carries information or cell structure and functionre.com/courses/20636/quizzes/61789/tChange of one right nucleotide for a different one in DNA sequenceContain nitrogenous base, pentose and phosphateProcess of converting RNA to proteinThree nucleotide that code for one amino acidContains nitrogenous base and pentose sugarv One copy of all chromosqmes in cellDNANucleotideContains nitrogenous base aNucleoside( Choose )TranscriptionProcess of converting DNA tTranslationProcess of converting RNA tHaploid( Choose]CodonThree nucleotide that code fMutationContain nitrogenous base, pt

a)Nucleotide: Contains nitrogenous base, pentose, and phosphate

Answered: Contains nitrogenous base and pentose…

Contains nitrogenous base and pentose sugar v One copy of all chromosqmes in cell DNA Nucleotide Contains nitrogenous base a Nucleoside | Choose ) Transcription Process of converting DNA t

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter3: The Cellular Level Of Organization

Section: Chapter Questions

Problem 16RQ: Which of the following structures could be found within the nucleolus? chromatin histones ribosomes...

See similar textbooks

Related questions

Q: What effect does a thymine dimer have on DNA synthesis?

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: DNA replication: ТАСССТАААGGTCAGCCCAAGATT Complimentary strand: Transcription: MRNA Translation:…

A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…

Q: DNA G C A strand DNA TA C TA C strand MRNA A U G U G codon TRNA anticod G on Amino Tryptoph Stop…

A: DNA is deoxyribonucleic acid which acts as a source of genetic material inside living organisms. DNA…

Q: Sticky ends are single stranded DNA overhangs that: O stabilize DNA from nucleases O form primers…

A: DNA ligases join DNA molecules together by synthesizing phosphodiester bonds between nucleotides…

Q: DNA replication begins at and ends at O start codon; stop codon O AUG; UAG Promoter; operator…

A: The expression of the genetic material occurs generally through the production of proteins, This…

Q: Which of these are a DNA sequence are which are a protein? Column A Column B 1. A gene's promoter a.…

A: RNA polymerase - Enzyme used to convert DNA into mRNA. Introns - non-coding part of the gene. Exon -…

Q: 3. DNA → ATG CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA TAG CGT ACG GTA ETE GEE ATE MRNA → ERNA →…

A: Note: As Per Bartleby Guidelines only first question is answered. For further answers repost the…

Q: DNA Original T GC G C CTA A C G A G Replication DNA Copy Transcription MRNA Translation 1RNA Amino…

A: We are answering 2nd image as first image is not clear. pls repost it with deatils.

Q: ws the standard (coding strand) DNA amino acids involved in protein synthesi plate strand is shown…

A: DNA replication is a process in which DNA itself form DNA . It is two stranded , ladder like and…

Q: 1. T DNA strand NUCLEUS MRNA CU CYTOPLASM 6. 5. Lysine 7. AAGUUU UGUUCA AA 4. 2.

A: CENTRAL DOGMA- Replication is the process when DNA replicates itself means it will make copies of…

Q: Single nucleotide polymorphisms are found ina. DNA. b. RNA.c. plasmidsd. siRNA

A: Introduction:- Single nucleotide polymorphisms are defined as loci with alleles that differ at a…

Q: ble opposite shows the standard (coding strand) DNA codes for the 20 amino acids involved in protein…

A: Introduction :- Gene expression is the process of formation of response or functional part through a…

Q: During transcription, an mRNA molecule is formed: *( Choose True if the statement is correct abourt…

A: Transcription: The process of making of mRNA from DNA carried out by an enzyme RNA polymerase.…

Q: DNA message #6: GTA-CGA-TGA-ACA-GTG-CTT-TGC Transcription to mRNA: CAU GCU ACU UGU CAC GAA ACG…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: table opposite shows the standard (coding strand et codes for the 20 amino acids involved in protein…

A: DNA is a nucleic acid.

Q: The circled portion labeled Y is known as a(n): O ribosome O DNA molecule codon TRNA molecule O…

A: The translation occurs in the cell's cytoplasm. Firstly, a nascent mRNA or pre-mRNA synthesized by…

Q: The nucleotide is adenine adenosine adenosine monophosphate cytidine prion

A: A nucleotide is the basic building block of nucleic acids like RNA and DNA. The nucleic acids act as…

Q: For the following sequence, transcribe and translate the sequence into a protein. Be sure to…

A: Given strand is DNA template strand- 3'-TACCACCCCCTGAGTGCTGGGATC-5' Transcription of template Strand…

Q: TEIIB O contacts the DNA at the BRE will bind only if TFIID is bound O is the third factor to bind…

A: TFIIB is a transcription factor that helps to initiate the process of RNA polymerase II production.…

Q: 3. DNA → TAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC MRNA → protein →

A: According to Bartleby guidelines, when multiple questions are posted we are allowed to answer the…

Q: Send A PEETRAS O

A: Transcription is the process of formation of RNA from the DNA.The transcription process takes place…

Q: DNA bases, when coiled to histones, become inaccessible to RNA polymerase. O True O False

A: DNA is negatively charged due to phosphate group present in the backbone. Histones are small…

Q: Which strand of DNA is used by RNA polymerase during transcription? O Coding strand O Lagging strand…

A: The process of transcribing a piece of DNA into RNA is known as transcription. Messenger RNA is made…

Q: DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in…

A: Mutation: - Random process - Non-directional - Most of the mutations are harmful - Most of the…

Q: Examine Figure 16.2b. Why do you think the motif of the DNA-binding protein shown is called a…

A: Deoxyribonucleic acid (DNA) binding proteins are proteins that attach to single stranded or double…

Q: When pieces of DNA that were not originally from a bacterial cell get integrated into its…

A: Introduction :- Bacteria are prokaryotic organisms . They do not have a well defined nucleus and…

Q: During transcription, the DNA can be modified by the enzyme DNA methyltransferase and will enhance…

A: Transcription can be defined as the initial step of the protein synthesis in which RNA is formed…

Q: What will happen if RNA polymerase fails to attach to the promoter? O Translation Will begin early.…

A: Introduction "Transcription Is The Process Of Formation Of An RNA Molecule From DNA". One Of The…

Q: 1: Transcription Transcription DNA nucleotides TAC АСА GAT TTT GTC ACT АТА MRNA codon AUG

A: The method of producing an RNA copy of a gene sequence is known as transcription. This duplicate,…

Q: Acyclovir is best said to be a / an: Select one: O a. nucleoside Ob. nuclear base C. MRNA drug Od…

A: Acyclovir : Acyclovir is an antiviral medicine generally used for the treatment of viral diseases.…

Q: DNA TRANSCRIPTION TRANSLATION REPLICATION (D) DNA template (B] 3'-5' (C) MRNA (E) New (F) Name of…

A: Transcription is the process of synthesizing an RNA by the action of a DNA dependent RNA Polymerase.…

Q: 1. Of which of these do your cells have the least of? A. MRNA B. FRNA C. TRNA D. NDNA E. Proteins 2.…

A: Cells are composed of different components, cell organelles and molecules that are responsible for…

Q: 1. True or False a) DNA bases, when coiled to histones, become inaccessible to RNA polymerase. b)…

A: Transcription is the process by which the information of DNA are copied into mRNA and this process…

Q: Here is a strand of DNA: 5'-ATCCCGAATTAT-3' give the complementary strand of RNA making sure its…

A: DNA unlike RNA is a double-stranded molecule. In molecular biology, the genetic information in DNA…

Q: he up with one word, seven letter or more, that can be spelled using only the one letter…

A: Synthesis of proteins from RNA is called translation and synthesis of RNA from DNA is called…

Q: 5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ if this is the dna sequence is the RNA sequence this…

A: Transcription is the process of the synthesis of mRNA from a DNA. This process occurs in the nucleus…

Q: The original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And…

A: mRNA Sequence: A U G U G G A A C C G C U G C U G A Amino Acid Sequence: METHIONINE…

Q: DNA pol I O is a single subunit enzyme has a 5' to 3' exonuclease activity has a 3'to 5 exonuclease…

A: DNA polymerase I is a single polypeptide chain consisting about 928 amino acids and has 109 kDa…

Q: G. Aureliano has a mutation in the blue-shaded nucleotide in the TEMPLATE DNA sequence. Instead of a…

A: Introduction :- A mutation is a change in our DNA sequence that happens as a result of errors in DNA…

Q: 1. DNA → CCT CTT ATG ACA CGG AGG GTA CGC TAT TCT ATG TÀA TECATA ATC mRNA → tRNA →CCI protein >

A: Following the discovery that DNA is the genetic material, a new field known as genomics arose. DNA,…

Q: TRNA is synthesized during transcription. OTrue O False Next Page Back

A: Tranfer RNA is a type of RNA molecule that help decode a messanger RNA and specifies an amino acid…

Q: DNA fragment A is 3' AGC CCG CTC CGA GGC TAA AAG CGT 5' is % of guanine in DNA fragment A is the 4th…

A: As per our company guidelines, we are supposed to answer only first 3 sub-parts. Kindly repost the…

Q: Draw an arrow underneath the DNA representing the RNA being made (be sure it starts in the right…

A: DNA or deoxuribonucleic acid is a polymer of deoxy ribonucleotides connected together via…

Q: Match Column A with Column B. pulls a portion of the DNA strands apart from each A. 3rd event other,…

A: The process of transcribing a piece of DNA into RNA is known as transcription. Messenger RNA is made…

Q: Choose the BEST answers: Transcription begins whe✔ Choose... gene and u DNA polymerase Choose...…

A: When an enzyme known as RNA Polymerase (RNA pol) binds to the template DNA strand and starts to…

Q: RNase H will remove ribonucleotide directly linked to the DNA end. True false

A: The capacity of nucleic acids to guide their own reproduction from monomers makes them unique.…

Q: Which enzyme is used by the bottom daughter strand but not by the top daughter strand? O RNA primase…

A: dna replication is the process by which parent dna makes two daughter strands . the given diagram is…

Q: ads 5' to 3' right to left. The nucleotides are numbered 1 to 100. REMINDER: For thi oblem,…

A: The central dogma of molecular biology is a metabolic process of cell where one strand of the double…

Q: DNA message #4: AAA-CTT-CGC-TGG-GTG-CTC-TCC-AAC-CTT-TCA-TCG Transcription to mRNA: UUU GAA GCG ACC…

A: The proteins are formed from the mRNA which is formed from the DNA by the process of Transcription,…

Question

100%

What would fit best for definitions?

Nucleic acid molecule that carries information or cell structure and function
re.com/courses/20636/quizzes/61789/t
Change of one right nucleotide for a different one in DNA sequence
Contain nitrogenous base, pentose and phosphate
Process of converting RNA to protein
Three nucleotide that code for one amino acid
Contains nitrogenous base and pentose sugar
v One copy of all chromosqmes in cell
DNA
Nucleotide
Contains nitrogenous base a
Nucleoside
( Choose )
Transcription
Process of converting DNA t
Translation
Process of converting RNA t
Haploid
( Choose]
Codon
Three nucleotide that code f
Mutation
Contain nitrogenous base, pt

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

STRUCTURE AND NOMENCLATURE BASE FROM THE PICTURE ANSWER THE FOLLOWING: ( I ALL READY ANWER IT BUT I'M NOT SURE WITH MY ANSWERS, PLEASE CORRECT MY ANSWER IF ITS WRONG. THANK YOU.) Give the ABBREVIATED NAME of the nucleotide in the 5' end. MY ANSWER IS AMP Name the fourth nucleotide from the 3' to 5' end. Use the 2 pointscorrect/appropriate punctuations, spacing and letter case based on thenomenclature. MY ANSWER IS Cytosine-5'-monophosphate What is the total number of hydrogen bonds formed from the complex of 2 pointsthe given structure? Give ONLY the NUMBER. MY ANSWER IS 10 How many 3',5'-Phosphodiester linkages were formed? from the complex 1 point of the given structure? Give ONLY the NUMBER of the linkages. MY ANSWER IS 3 Give the ABBREVIATED NAME of the nucleotide in the 3' end. MY ANSWER IS U Name the first complementary base from the 5' direction. USE ALL 1 pointCAPITAL LETTERS ONLY. MY ANSWER IS ADENOSINE-5'-MONOPHOSPHATE How many terminal phosphate/s is/are present in the…
4. Indicate whether each of the following words orphrases applies to proteins, DNA, or both.a. a macromolecule composed of a string of subunitsb. double-strandedc. four different subunitsd. 20 different subunitse. composed of amino acidsf. composed of nucleotidesg. contains a code used to generate othermacromoleculesh. performs chemical reactions
Write the detail or exact information of the following of molecule “X” with UniProtKB accession number P18564. I. Chromosome number:II. Protein size:III. Number of exons:IV. Stop codon:V. Size of the longest exon in nucleotides
DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, whats the non-template/sense/coding strand from the STARND DNA? also what's the arrangement of m-RNA and the chain arrangement of the amino acids that will be made according to the order of the RNA?PLS DONT ANSWER THE DEFINITION ONLY, READ THE QUESTION CAREFULLY
a. Do any strands of nucleic acid exist in nature inwhich part of the strand is DNA and part is RNA?If so, describe when such strands of nucleic acidare synthesized. Is the RNA component at the 5′end or at the 3′ end?b. RNA primers in Okazaki fragments are usually veryshort, less than 10 nucleotides and sometimes asshort at 2 nucleotides in length. What does this facttell you about the processivity of the primaseenzyme—that is, the relative ability of the enzymeto continue polymerization as opposed to dissociatingfrom the template and from the molecule beingsynthesized? Which enzyme is likely to have a greaterprocessivity, primase or DNA polymerase III?
Write TRUE/FALSE in number 6,7,8,9,10 ____6. “ Prokaryotic ribosomes is made of 40S and 60S subunits.” ____7. “ Prokaryotic DNA is normally complexed with histone proteins.” ____8. It is also possible for a linear DNA (i.e. eukaryotic DNA) to assume a supercoiled conformation. ____9. An Adenine-Thymine base-pair contain 3 H-bonds. ____10. If circular DNA is positively supercoiled, the writhe will be clockwise.
Let’s return to your patient with sickle cell anemia. Below is the RNA sequence from your patient and from her mother. (The ••• represents another 30 nucleotides not written out here). The affected nucleotide is indicated in BOLD. Patient’s RNA: 5’ –CUAUGACAGAGUUC•••CAUUAGCCA – 3’ Mother’s RNA: 5’ –CUAUGACAGUGUUC•••CAUUAGCCA – 3’ A) Write out the first 10 nucleotides corresponding to the DNA sequence of the coding strand for your patient in the 5' to 3' direction. B) From the information you have been given, why is it not possible to accurately write out the DNA sequence as it would really be found in the genome? (ie, what you wrote down in part A is NOT necessarily what the DNA sequence would really look like if we could examine the chromosome directly - why? And no this has nothing to do with the 30 nucleotides that aren’t written out or the mutated base). Your answer should be 1-2 sentences maximum.
Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde / Human DNA sequence ATG TGT CCA TTA ACG TGC ACA Name the codon that is formed from base triplet number 2 on the DNA sequence. Write down the names of the amino acids coded for by base triplets 6 and 7. Write down the full names Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following: the amino terminus (N) the carboxyl terminus (C) a peptide bond an α-carbon atom If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed? E.The following is a sequence of base triplets in DNA F.If guanine, found in the first base…
Multiple Matching. Fill in the blanks with all the letters of thewords below that apply.________ site of protein synthesis________ carries the codon________ carries the anticodon________ a process synonymous with mRNA synthesis________ bacteriophages participate in this transfer________ duplication of the DNA molecule________ process in which transcribed DNA code is decipheredinto a polypeptide________ involves plasmidsa. replicationb. tRNAc. conjugationd. ribosomee. transductionf. mRNAg. transcriptionh. transformationi. translationj. none of these
Show the structure of a DNA where the lead strand is ATCG. Show H-, glycosidic, phosphoester bondings.4. Differentiate replication, transcription and translation by describing the changes which occur in each process.
Base on the coding strand of DNA: ATG GGA ATT CGC What is the sequence of the complementary template strand of DNA that pairs with the coding strand?
What role do the following cellular components play in thestorage, expression, or transmission of genetic information: nucleolus