ws the standard (coding strand) DNA amino acids involved in protein synthesi plate strand is shown below. TGCCCG-3' quence of amino acids formed when t transcribed and translated.
Q: DIR TION: Express the following DNA nucleotide bases into amino acids A. 1. 3' ATA TTT CCG TAC CGC…
A: Gene expression is the process by which information from a gene is used in the synthesis of a…
Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…
A: Answer: Central Dogma : It is the complete process of replication of DNA, transcription of DNA to…
Q: 2. Complete the leading strand and the complementary strand vith the 5'and 3' ends and identify he…
A: DNA replication is the process by which a new DNA molecule is formed and this process is known as…
Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…
A: The template strand is a DNA strand that functions as a template for the synthesis of complementary…
Q: Which of the fokmang the first event to take place in A base pairing of activated methionine-IRNA to…
A: Transcription is the process of making RNA copy of DNA. Translation is the process of making…
Q: This happens during DNA transcription: O RNA nucleotide bases form hydrogen bonds to DNA nucleotide…
A: Note- As you have posted multiple independent questions, in the same request, we will solve the…
Q: In a DNA leading strand TCCAAGAAT, the lagging strand will be AGGTTCTTA. * TRUE O FALSE If the…
A: DNA is a molecule made up of two polynucleotide chains that wind around each other to form a double…
Q: DNA replication begins at and ends at O start codon; stop codon O AUG; UAG Promoter; operator…
A: The expression of the genetic material occurs generally through the production of proteins, This…
Q: 3. DNA → ATG CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA TAG CGT ACG GTA ETE GEE ATE MRNA → ERNA →…
A: Note: As Per Bartleby Guidelines only first question is answered. For further answers repost the…
Q: The coding strand of DNA in a segment of a gene is as follows:ATG GGC CTT AGC. This strand carries…
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: G The gamete that conteins the X + gy com…
A: Central Dogma explains the flow of genetic information. It states that the genetic information is…
Q: 2. What are IC TArE Codon marks theste at wNch translati PART D. Directions: Identify the mutated…
A: In the given question the normal DNA is TAC-CCC- GTC- ACC- GCC- TAT-ATC. The normal RNA formed from…
Q: Mutated DNA Sequence #3 T A C A C C T TAG C GACGACT... What's the mRNA sequence? (Circle the change)…
A: DNA sequencing is the process of determining the nucleic acid sequence in the order of the…
Q: STCATCTTGACATTG... 3' same strand now has a single base insertion of an A, indicated in blue. What…
A: A mutation is known as the changes or alteration brought in the DNA sequence which can change the…
Q: 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the mRNA…
A: The coding strand of DNA is the one that contains the instructions for the gene in concern. The…
Q: ble opposite shows the standard (coding strand) DNA codes for the 20 amino acids involved in protein…
A: Introduction :- Gene expression is the process of formation of response or functional part through a…
Q: Which of the following is true at the time introns are spliced our nRNA? O Only the 3' end of MRNA…
A: Introns are defined as noncoding sections of an RNA transcript, or it can be the DNA encoding it.…
Q: Give the COMPLIMENTARY DNA strand. 3'TAC TAC TTT AMA TCA CTC TCC GCT GGT GTG AGT TGC CCT ACT 5
A: Deoxyribonucleic acid or DNA is a biomolecule composed of two polynucleotide chains that coil around…
Q: table opposite shows the standard (coding strand et codes for the 20 amino acids involved in protein…
A: DNA is a nucleic acid.
Q: TEIIB O contacts the DNA at the BRE will bind only if TFIID is bound O is the third factor to bind…
A: TFIIB is a transcription factor that helps to initiate the process of RNA polymerase II production.…
Q: UI ue bew strand requires the addition of a new dNTP to the 3 -OH g1 group of ovdes the immediate…
A: The synthesis of complementary DNA strand is called DNA replication.It is a very complex process…
Q: 3. DNA → TAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC MRNA → protein →
A: According to Bartleby guidelines, when multiple questions are posted we are allowed to answer the…
Q: s the standard mino acids involved in protein synthesi late strand is shown below GCCCG-3' uence of…
A:
Q: DNA bases, when coiled to histones, become inaccessible to RNA polymerase. O True O False
A: DNA is negatively charged due to phosphate group present in the backbone. Histones are small…
Q: I’m supposed to translate tRNA into amino acids for each codon of the previous question and state…
A: Hi. After accepting the question, I see that you have incorrectly solved 2b and 2c. I am giving you…
Q: DNA coding strand ATG GGA ATT CGC can not get this what the sequence of the complementary template…
A: The DNA strand which functions as template for RNA synthesis is known as template strand, minus…
Q: ow many amino acids will the mRNA sequence "AUG GAC CUG UCG A" produce? (LS1-1) *
A: Amino acids production.
Q: Mutated DNA Sequence #1 TACAT CTTGG C G A C G ACT... What's the mRNA sequence? (Circle the change)…
A: Mutations are changes that occur in the nucleotide sequence of DNA. The mutations can be somatic,…
Q: during sicing,introns of pre-mRNAs go through an intermediate stage when they are shapedlike: a…
A: RNA is the intermediate molecule in the central dogma . They carry forward the information stored in…
Q: . The table opposite shows the standard (coding strand) DNA riplet codes for the 20 amino acids…
A: Introduction The process of synthesis of proteins occurs in two steps which are transcription and…
Q: 2a. The DNA is mutated on the 4th base pair to the following: DNA:3'TAC GAT GAG GTC 5' АTG CТА СТС…
A: No, this mutation might not change the way in which the protein functions. In this mutation the…
Q: Protein undergoes modifications in ER before reaching their final destination. True O False pH of…
A: Proteins are synthesized by ribosomes which translate mRNa in polypeptide chains . These proteins…
Q: e nucleotide sequence of this anticodon loop under tant tRNA will, a) Recognize GCC as the codon for…
A: tRNA refers to transfer RNA. It helps in decoding an mRNA sequence into a protein. Three nucleotides…
Q: Base on the template strand of DNA: GAT CTC ATA GHC what is the sequence of mRNA that will be…
A: Transcription is part of the Central dogma. In transcription, messenger RNA (mRNA) is transcribed…
Q: RNaseP O processes the 5' end of tRNAS contains an RNA component O both a and b O none of the above
A: A ribonuclease is an enzyme that cleaves ribonucleic acid (RNA). RNA is a single stranded structure…
Q: What are the correct codons of the MRNA from the given DNA strand th needs to be transcribed? *…
A: Sense strand It is also called as the coding strand , plus strand or the non template strand. The…
Q: vhat RNA amino acid sequences does the coding strand speciry? Coding strand: Template strand: RNA:…
A: DNA is a molecule composed of two polynucleotide chains that coil around each other to form a double…
Q: UACTyrosine (Tyr) Fcysteine (Cys) Consider the following DNA coding strand: 5' - ATGTACGGC GAATAA-3'…
A: Within the biological system, the flow of genetic information is explained as molecular biology's…
Q: which of the follocoing waeleng ths ranges is use d to measue absorbence of DNAĄ 10 0 - 2oonm 200…
A: Deoxyribonucleic acid(DNA) is one of the most important biochemical compounds for living cells. It…
Q: 1. DNA → CCT CTT ATG ACA CGG AGG GTA CGC TAT TCT ATG TÀA TECATA ATC mRNA → tRNA →CCI protein >
A: Following the discovery that DNA is the genetic material, a new field known as genomics arose. DNA,…
Q: s of this information, is the hereditary information of the ribg rirus RNA or DNA? Is it likely to…
A: Wether of virus is an RNA or DNA virus depends on its base composition and their percentages.
Q: Given the coding strand DNA sequence below, what change would occur in the expressed protein…
A: The DNA sequence of the unmutated version is: 5' AATGCCGTAA 3' After insertion of C between the last…
Q: uit L Tepresents part of a DNA molecule. 5' T ATGCTT C CA TACG A AGG TCA 3' 3' G T Figure 2 (c)…
A: The process of replicating a double-stranded DNA molecule into two identical DNA molecules is known…
Q: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this…
A: DNA (deoxyribonucleic acid) is the hereditary unit of an organism. DNA is a double helical structure…
Q: Original DNA ЗТАС ACC TTG GCG ACG ACT'S sequence: MRNA transcript: amino acids: Is the "original DNA…
A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that act as genetic…
Q: A DNA-binding protein recognizes the following…
A: BASIC INFORMATION NUCLEIC ACID The molecules which hold the ability to carry information of cells…
Step by step
Solved in 3 steps
- a) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.) 2. b) Is the top or bottom DNA strand the template strand?3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?
- Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)Write down the major differences between DNA and RNA.keeping in mind the concept of "central dogma". Explain whether the information from protien is transfered to DNA? If yes/No, explain.Write down the major differences between DNA and RNA. Keeping in mind the concept of “central dogma “explain whether the information from protein is transferred to DNA? If Yes/No, explain.with daigrms
- a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =Explain the effect(s) the following scenarios would have on DNA replication or translation. For each scenario, state whether DNA replication or translation would be able to proceed and explain your reasoning. Low amount of 7- methyl guanosine in the nucleus low amount of DNA polymerase I lack of helicaseConsider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
- From standpoint of replication and transcription, explain how RNA polymerase is allowed to incorporate the first nucleotide whereas DNA polymerase needs a primer. Explain how this difference impacts the process of replication and transcription.5. Consider the following DNA template strand:3’ GCA- AAA-CAA-ATA-GTG 5’Using the following sequence, identify:a. The base sequence in the DNA information strandb. Assuming that no introns are present, identify the codons present in the mRNA transcribed from the DNA template strandc. The anticodons in the tRNA that with interact with the mRNA codons in (b).d. The amino acids that will be carried by the tRNA (from c) molecules1. Using the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing cut fragments would appear. The linear uncut DNA is 640 base pairs in length. Insert an image below.