Transcribe and Translate the DNA strand: ORIGINAL DNA TAC/ACC/TTG/GCG/ACG/ Strand: RNA strand: Amino Acid sequence: All the DNA strands below are mutated from this Original strand. Please transcribe and translate the DNA strands below and then compare the mutated strands to the ORIGINAL above. Highlight the changes. Tell me what type of mutation has occurred. Mutated DNA Strand #1 Mutated DNA strand #1: TAC/ATC/TTG/GCG/ACG/A RNA strand: Amino Acid sequence: What type of mutation is this? Will there likely be effects? Mutated DNA Strand #2 Mutated DNA strand #2: TAC/GAC/CTT/GGC/GAC/G. RNA strand: Amino Acid sequence:

Q: Put a primer on the top and bottom of bubble at origin. Identify 3’ ends. You can use a thicker line…

A: For DNA replication to occur, following steps take place -

Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…

A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…

Q: In denatured DNA, DNA double helix is disrupted, which causes the exposure of the bases and thus…

A: The correct option is the C option: In denatured DNA, DNA double helix is disrupted, which causes…

Q: Which DNA polymerase in prokaryotes is involved in the replacement of primers with deoxynucleotides?…

A: DNA polymerase is the enzyme that catalyses the replication of DNA. DNA polymerase cannot synthesise…

Q: Describe and diagram the DNA damage done by UV radiation on a single strand of DNA. Describe in at…

A: The DNA molecules that encode its genome in human cells DNA damage is subdivided into two types:…

Q: Which of the following is matched correctly? DNA helicase: unwinds DNA prior to transcription ODNA…

A: RNA polymerase consists of five different subunits. RNA polymerase with all five subunits is known…

Q: Fill in the blank spaces below with the most appropriate terms. The word bank is not provided. DNA…

A: During cell division DNA makes a copy of itself and this process is called DNA replication. In this…

Q: Match the following polymerases with their function. + DNA Polymerase III DNA polymerase I + RNA…

A: Polymerase : There are a set of enzymes specific for DNA & RNA mainly responsible for…

Q: Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction…

A: ••Complimentary strand of DNA is made by by process of Replication Replication is process in which…

Q: MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA…

A: Answer) The correct sequence of base pairs in mRNA would be - 5' AGGCACCAAAUAUGU 3'…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: Answer the following Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’…

A: The central dogma depicts the flow of genetic information into cells, the replication of genomic…

Q: Refers to the two strands of DNA double helix. Please choose one answer only.  A. Nicks B. Templates…

A: Introduction: As it relates to genomics, the phrase "double helix" is used to define the actual…

Q: Choose the right combination of components required to set up a polymerase chain reaction from the…

A: Polymerase chain reaction is a method widely used to rapidly make millions to billions of copies of…

Q: Refer to the image and answer the questions 1. How are Okazaki fragments joined together? 2. Where…

A: The replication fork is a structure that forms within the long helical DNA during DNA replication.…

Q: Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA…

A: DNA extraction procedure refers to the methodology that is followed to purify the the DNA (cellular…

Q: ntify the type of mutation and how it would affect the protein made (amino acid) if the following…

A: DNA is what is inside the nucleus of mostly all cells. It carries the genetic information which is…

Q: Please draw the DNA denaturation (DNA melting) curves corresponding to the three molecules and…

A: DNA denaturation is the breaking down of DNA molecule, for comparison or sequencing. DNA can be…

Q: Whatis the purpose of the dideoxynucleotides in DNA sequencing? OCH2 base - OCH2 base H. H. H. H. H.…

A: ddNTP(dideoxynucleotide triphosphate) used in sanger dna sequencing .which terminate the…

Q: There is segment of double-stranded DNA that is found to have a total of 140 bases. If 45 of those…

A: DNA( deoxyribonucleic acid )  is two stranded ladder like structure which contain four bases :-…

Q: Which of the following best explains the leading daughter DNA strand? The leading strand is…

A:

Q: A frameshift mutation occurs in a DNA strand. The mutation is a deletion of the two nucleotides…

A: A frameshift mutation is a genetic mutation caused by a deletion or insertion in a DNA sequence that…

Q: DNA Fragments: CGATCT TCACGA AGCTGC GGCTAA ATGCTG GTACCA Select the correct fragments from the…

A: DNA is a nucleic acid that is present in the nucleus of eukaryotic cells and the nucleoid region of…

Q: Circle the following elements that are directly involved in DNA replication process  DNA helicase…

A: Introduction: DNA replication is the process in which two identical DNA daughter strands are…

Q: how enzymes are involved with proofreading newly formed DNA molecules.   1. DNA polymerase does not…

A: In proofreading process, The polymerase checks whether the recently added base has matched…

Q: Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the…

A: Replication is the process of synthesis of new strands of DNA from the parental DNA molecule and it…

Q: What can cause mutations in the DNA sequence? Select all that apply.   a.Exposure of cells to…

A: Mutation is the heritable change in the sequence of nucleotides in a DNA molecule. If a change in…

Q: What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5…

A: DNA stands for deoxyribonucleic Acid. It is a long polymer of deoxyribonucleotides. It is found in…

Q: Match term to definition Anneal Replication Translation Transcription a. Process of making a copy of…

A: Replication and transcription processes occur in the nucleus of the eukaryotic cell. The translation…

Q: The enzyme that removes the RNA primer from the Okazaki fragment is:   DNA pol III   DNA ligase…

A: Introduction: DNA is the hereditary material that defines every cell. It is found within the nucleus…

Q: Draw the following segment of DNA molecule. Show the important covalent and non-covalent…

A: Covalent bond is formed by sharing of electrons between adjacent atoms. For example, bond formed…

Q: Below is a DNA strand.  We will call this the original strand, and you will transcribe and translate…

A: Transcription is the process in which mRNA is synthesized from DNA . This process takes place inside…

Q: For each function, please name the enzyme or ribozyme that performs the function.  1. Transcribes…

A: DNA are transcribed into RNA and then the RNA is translated into function proteins in cells.…

Q: The diagram shows an autoradiograph of a DNA sequencing gel. What is the 5' to 3' sequence of the…

A: Gel electrophoresis is a technique which is used to separate the molecules based on the size of the…

Q: Which enzyme can recognize an altered base in the DNA? Group of answer choices DNA Polymerase AP…

A: There are several DNA repair mechanisms are present that are- direct repair system, excision repair…

Q: Name the enzymes that cut the DNA at specific sequences and create sticky ends.

A: A substance produced by a living organism that acts as a catalyst to bring about a specific…

Q: pol III moves 5 pol I replaces primer A with DNA pol I binds to 5 end of primer A DNA ligase links…

A: DNA replication is the biological process of producing two identical replicas of DNA from one…

Q: The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion…

A: DNA molecule is the genetic material present in the animals. Genetic material  is present in the…

Q: The line below depicts a DNA segment from a eukaryote. In this case, only the top, coding strand, is…

A: Eukaryotic DNA is enclosed within a double membrane bound nucleus. In eukaryotic transcription,…

Q: Which of the sequences below would serve as a PCR primer that would bind this DNA strand: 5'-…

A: PCR is polymerase chain reaction. It is a method of DNA amplification developed by Kerry Mullis.…

Q: What enzyme replaces the RNA primers on the Okazaki fragments on the lagging strand? DNA Pol II

A: DNA replication is the process by which DNA duplicates itself. One of the most important feature of…

Q: is the name of the protein that unwinds double stranded DNA e is the term used to refer to newly…

A:

Q: Make the complementary strand for the following DNA template and label both strands as 5’ to 3’ or…

A: There is complementary pairing between the two strands of DNA that is adenine always pairs with…

Q: What will be the MRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…

A: The template strand is the DNA strand from which mRNA is made. The non-template, or coding, strand…

Q: . A short homologous sequence called the macrohomologies which connects break ends of the strands.…

A: Short Homologous sequence Is known as Microhomology sequence.  It involves asingment of…

Q: Use the set of gene sequencing results below to answer the question that follows: A G C T -Wells I…

A: Gel electrophoresis is a laboratory method used to separate mixtures of DNA, RNA, or proteins…

Q: Regular DNA replication Question 3 options: Occurs through the addition of nucleotides to the end of…

A: dna replication is the process by which new dna molecules are produced from parent dna molecule .

Q: The steps that involve complementary base pairing is the second step in which the nucleotide is…

A: 1. DNA replication is the process by which two identical copies of the DNA template strand is…

Q: In the figure, which ketter represents DNA polymerase 1 D AR AA BB C.C DD EE

A: Polymerase A kind of enzyme that make DNA or RNA from pre-existing DNA or RNA.

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.