Please please please. Help me answer letter d and e please. Thank you so muchhh Enumerate and define the steps/processes involved in replication. 2 Suppose the following base sequence was found in a 20-base DNA polymer.CENTRAL DOGMA OF MOLECULAR GENETICSQuestions:a. Replication outputа.b. Transcriptionc. Translation2 Suppose the following base sequence was found in a 20-base DNA polymer.3'CAG TTA AGG CTC СТА GGT TА 5'a What would be the first 5 bases at the 3' end of the complementary strarid?3' TA A CCb. What would be the first 10 bases at the 5' of the complementary strand?I'G TC AAT 1CC GC. Assuming the presence of the complementary strand, what is the percentagecomposition of the polymer with respect to the A-T base pair and with respect tothe C-G base pair?d. In the given segment, illustrate and indicate the direction of synthesis of:1. a 5-nucleotide RNA primer2. a 2-nucleotide Okazaki fragment

we are answering D part E part is missing pls repost for E part.

Answered: d. In the given segment, illustrate and…

d. In the given segment, illustrate and indicate the direction of synthesis of: 1. a 5-nucleotide RNA primer 2. a 2-nucleotide Okazaki fragment

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter14: Dna Structure And Replication

Section: Chapter Questions

Problem 4TYK: Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand...

See similar textbooks

Related questions

Q: Describe the different stages that process of Protein synthesis.

A: Protein synthesis is the cycle where cells make proteins. It happens in two phases: transcription…

Q: c) Give an account of how messenger RNA (mRNA) is produced in the cell nucleus (transcription) and…

A: Hoe mRNA is produced in cell nucleus : in molecular biology messenger RNA ( ribonucleic acid ) is a…

Q: II. Do what is asked A. 1. a. Use the codon given below to complete the following table. Assume that…

Q: Describe the process of protein synthesis and localize where each step takes place. Use the…

A: Protein synthesis is one of the major processes, which helps in the synthesis of protein for the…

Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: The template strand is a DNA strand that functions as a template for the synthesis of complementary…

Q: Describe the process of translation, focusing on the role of mRNA, ribosomes, ribosome-binding…

A: All the living cells are made up of protein, which act as building blocks for every organism. These…

Q: Describe the process of protein synthesis and associated post translational modifications.

A: Post-translational modification (PTM) refers to the covalent and generally enzymatic modification of…

Q: Explain the process of translation, including location, processes, and molecules involved

A: Replication, transcription, and translation are the basic process in the molecular dogma of the…

Q: State the function of histones in DNA packaging.

A: Histones are highly basic proteins because they are rich in lysine and arginine residues. They are…

Q: (A) involves the formation of a peptide bond between the amino acid and tRNA

Q: Transcribe the following DNA strand into MRNA and translate that strand into a polypeptide chain,…

A: DNA is made up of small units known as genes. These genes store all the hereditary information which…

Q: Compare the severity of DNA mutations that produce the following changes in mRNA codons:(a) GCU to…

A: The genetic material is transferred to the next generation through reproduction. The sequence of the…

Q: Indicate 2 ways which ensure DNA fidelity when carrying the message to protein which occur in the…

A: DNA fidelity refers to the ability of the DNA polymerase to avoid or rectify the errors made in the…

Q: List the 4 types of RNA degradation and describe each in 1 sentence

A: RNA degradation is the process by which ribonucleic acid molecules are enzymatically degraded. It is…

Q: Describe nucleotide excision repair.

A: A nucleotide is defined as a structure that will consist of a sugar molecule (that can be either…

Q: Describe DNA synthesis in detail with the help of diagrams

A: DNA synthesis is DNA replication. It occurs in three stages- initiation, elongation and termination.…

Q: In details summarize the process of Translation and post translation process.

A: Translation: Nucleotide language is transfer to language of amino acids. In short mRNA language is…

Q: a) What was the full peptide sequence before degradation? b) Paula thought she forgot to treat her…

A: Edmans degradation is a method of sequencing the amino acids in the peptide. In this first step…

Q: a) Identify three types of RNA and provide a description of each and the role they play in protein…

A: a. Mejor type or RNA is 1. Messanger RNA (mRNA) 2. Ribosomal RNA (rRNA) 3. Transfer RNA (tRNA)…

Q: Discuss the genetic code, and explain how it works withdifferent types of RNA to make a protein.

A: A gene is a unit of hereditary present in thousands of numbers on the helical strands of…

Q: D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key…

A: The self replicating biomolecules that are present in the chromosomes and carry genetic information…

Q: Caption a diagram of translation, identifying each step in the process and the role of each type of…

A: The process of protein synthesis by ribosomes in the cytoplasm or endoplasmic reticulum is known as…

Q: Explain how the DNA code may be copied, and describe the basicfunctions of RNA.

A: The basic process of copying DNA is called DNA replication. DNA is copied and a new molecule of DNA…

Q: 2. Identify the following structures when given images such as the ones below: ● process of…

A: Introduction The cell is the basic structural and functional unit of life present in all living…

Q: Describe how proteins are sequenced, and explain why sequence determination is important

A: Protein sequencing is the technique to determine the amino acid sequence of a protein. Proteins are…

Q: State the purpose of DNA replication and describe the process

A: DNA (deoxyribonucleic acid) is the genetic material which plays an important role in the transfer of…

Q: (c) With the indication of sense strand, template strand, the direction of transcription, provide…

A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…

Q: Explain the DNA translation process

A: DNA Translation: The process of translating the sequence of a messenger RNA…

Q: Using seven numbered steps, describe the process of translation.

A: Translation : It is the process of translating the sequence of mRNA molecule to a sequence of amino…

Q: ) How is the lagging strand made in DNA replication? Include important enzymes and structures.…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: explain the feature of DNA replication and how this replication is considered accurate

A: DNA replication is the interaction by which a double stranded DNA molecule is duplicated to create…

Q: explain Nucleotide excision repair

A: Nucleotide excision repair is one of the defined methods of DNA repair. It is characterized by the…

Q: ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: State the direction of movement of the ribosome along the mRNA strand (the direction of…

A: Protein synthesis involves translation of mRNA into protein that requires three complex stages:…

Q: Explain the DNA repair defects .

A: DNA repair is a process in which cell identifies any defect in the DNA and correct it. Cells cannot…

Q: Write a paragraph about transcription, and include the following terms: transcription factors,…

A: Transcription is a process in which RNA molecule is produced from the DNA template strand or non…

Q: (d), Provide an overview on the replication of DNA. Provide the double-helix model of DNA.

A: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that form a double…

Q: n the given segment, illustrate and indicate the direction of synthesis of: a.) a 5-nucleotide RNA…

A: The replication process initiates with the unwinding of the polynucleotide strand forming a…

Q: Discuss the difference between intron and Exon

A: Exons are named as nucleic acid coding successions & they are available in mRNA. Introns are…

Q: Explain the genetic alterations resulting in protein synthesis defects and their relationship to…

A: In genetics, the genetic alterations is defined as the abnormalities that is caused due to the…

Q: Explain the process of Transcription and Translation. List three antibiotics and explain how these…

A: All the genetic information needed by the cell to perform its activities is encoded and stored in…

Q: In nucleic acid Differentiate: gene, genome and gene expression

A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…

Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: Translation is process in which proteins are synthesized.

Q: Describe the consequences of removing or adding nucleotides.

A: Changes in nucleotide bases produce mutations, which are errors in codons. It's possible that…

Q: State the dependent and Independent Variables in the process of RNA and Protein Synthesis lab

A: Transcription is a process of RNA production from the DNA template. This process occurs within the…

Question

Please please please. Help me answer letter d and e please. Thank you so muchhh

Enumerate and define the steps/processes involved in replication.

2 Suppose the following base sequence was found in a 20-base DNA polymer.
CENTRAL DOGMA OF MOLECULAR GENETICS
Questions:
a. Replication output
а.
b. Transcription
c. Translation
2 Suppose the following base sequence was found in a 20-base DNA polymer.
3'CAG TTA AGG CTC СТА GGT TА 5'
a What would be the first 5 bases at the 3' end of the complementary strarid?
3' TA A CC
b. What would be the first 10 bases at the 5' of the complementary strand?
I'G TC AAT 1CC G
C. Assuming the presence of the complementary strand, what is the percentage
composition of the polymer with respect to the A-T base pair and with respect to
the C-G base pair?
d. In the given segment, illustrate and indicate the direction of synthesis of:
1. a 5-nucleotide RNA primer
2. a 2-nucleotide Okazaki fragment

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following statements about DNA is false? a. Phosphate is linked to the 5 and 3 carbons of adjacentdeoxyribose molecules. b. DNA is bidirectional in its synthesis. c. Each side of the helix is antiparallel to the other. d. The binding of adenine to thymine is through three hydrogenbonds. e. Avery identified DNA as the transforming factor in crossesbetween smooth and rough bacteria.
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
3. Now that the sequence of the entire E. coli K12 straingenome (roughly 5 Mb) is known, you can determineexactly where a cloned fragment of DNA came fromin the genome by sequencing a few bases and matching that data with genomic information.a. About how many nucleotides of sequence information would you need to determine exactly where afragment is from?b. If you had purified a protein from E. coli cells,roughly how many amino acids of that proteinwould you need to know to establish which geneencoded the protein?c. You determine 100 nucleotides of sequence ofgenomic DNA from a different E. coli strain, butyou cannot find a match in the E. coli K12 genomesequence. How is this possible?
2. You are cloning the genome of a new DNA virus into pUC18. You plate out your transformants on ampicillin plates con-taining X-gal and pick one blue colony and one white colony. When you check the size of the inserts in each plasmid (blueand white), you are surprised to fi nd that the plasmid fromthe blue colony contains a very small insert of approximately60 bp, while the plasmid from the white colony does notappear to contain any insert at all. Explain these results.
4. A recent estimate of the rate of base substitutions atSNP loci is about 1 × 10−8 per nucleotide pair pergamete.a. Based on this estimate, about how many de novomutations (that is, mutations not found in the genomes of your parents) are present in your own genome?b. Where and when did these de novo mutations inyour genome most likely occur?
3. Replicate the following segment of DNA. 5'-ATCGGCTACGTTCAC-3' 3'- TAGCCGATGCAAGTG-5'; and show the direction of the new strands and explain lagging and leading strands are, also explain how this is semiconservative replicatication. Are the new strands identical to the original segments of DNA?
1. How can you modify your DNA model to reflect changes among DNA molecules? 2. How can a DNA molecule make an exact copy of itself?
#3 under Identify the Structures is what? A. phosphate polymerase complex B. DNA polymerase complex C. deoxyribose sugar polymerase complex D. nitrogen base polymerase complex
3. Using the same template strand, transcribe the DNA:GCA TAG CAA TGC
1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…
1.) A portion of a strand of a much longer molecule has a nucleotide sequence AGC – AGG – CAG - ATC, if this strand is replicated, what will be its complimentary strand? a.)TCG – TCC – GTC - TAG b.)AGC - AGG – CAG - AUC c.)AGC – AGG – CAG - ATC b.)UCG – UCC – GUC – UAG 2.)If the environment gets cold, we often shiver to____ a.)decrease body temperature b.)keep body temperature the same as the external temperature c.)regulate blood pressure d.)increase body temperature 3.)How does a neuron transmit a message from cell to cell? A nerve impulse travel_ a.)from the end of the axon, through the cell body up to the dendrite’s terminal, then across the synapse to the axon of another neuron b.)from the dendrites of one neuron to the dendrites of another neuron passing the cell body to the synapse of the axon c.)from the end of dendrite, through the cell body, down the axon terminals, then travels across the synapse to the dendrite of another neuron d.)from the axon of one neuron to the…
2. Provide the sequences of the template and coding strands of a DNA double helix that was used to produce this RNA: 5’-GGCAUGCAUUACGGCAU. Be sure to label the 5’ ends.