ii c) A gene in a bacteria has the following DNA sequences (the promoter sequence ispositioned to the left but is not shown):5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3'3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5'i) By referring to the codon table below, write the corresponding mRNA transcript andpolypeptide translated from this DNA strand.2Second letterсAGUUUPheUUCUUAUUG LeuUCUUCCUCAUCGUAU TyrUACSSerUAA Stop UGA Stop AUGUUGCUAG Stop UGG Trp GCAUTHISCACCAA GinCCUСССCUUCỤCCUACUGCGUCCArgLeuProССАCGAACCG)CAG.CGGGAAUAGU serAUUACUAsnAAC.AUC FleAUAAUG Met ACGАСCAGCAGA ArgThrACAAAAAAGLYSAGGGAUAspGAC.GGUGGCGlyGUUGCUGỤCValGUAGCCAlaGCAGAA1GluGAG.GGAGUGGCGJGGGGii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation thatresulted in deletion of the C:G base pair, what will be the resulting amino acid sequencefollowing transcription and translation?First letterDUAGThird letter

A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation?

ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...

See similar textbooks

Related questions

Q: What events bring about the termination of translation?

A: The translation process occurs in the cytoplasm. Translation in regards to DNA describes the process…

Q: What are the blockers of translation?

A: Introduction: Translation is the process in which there is formation of a polypeptide chain from…

Q: Why will a mistake in the RNA code alone not become a mutation?

A: A change in the genetic code is called a mutation when it becomes a permanent part of the genome of…

Q: Define the following terms: genetic code, codon, and anticodon. What is the relationship among the…

A: DNA is the storehouse of information in living organisms. It is present inside the nucleus of every…

Q: What is the difference between a charged tRNA and an uncharged tRNA?

A: Answer: Introduction: Transfer RNA (tRNA) is the type of RNA, consist of a small RNA molecule which…

Q: If a mutation eliminated the start codon from a gene, howwould the mutation affect transcription,…

A: The mutation is the change or alteration in the nucleotide sequence of the genome. The mutations can…

Q: What happens in initiation, elongation, and termination during translation?

A: The translation is the process by which the proteins are synthesized. The information stored in the…

Q: If a DNA sequence (exons and introns) and the regions upstream/downstream are normal -- but no mRNA…

A: During RNA splicing Introns are removed and Exons ligated together to give rise to a functional RNA…

Q: . What is the biological benefit of a degenerate genetic code?

A: Genetic code is the set of nucleotide bases, which are known to carry genetic information from the…

Q: What would be the effect of an insertion or deletion of one of the bases in a codon?

A: Mutation may be defined as change in single or multiple base pairs resulting in altered phenotype.…

Q: The codon is found on mRNA? True or False?

A: Codon is a sequence of three consecutive nucleotides in DNA or RNA, that codes for a specific amino…

Q: Define translation process?

A: All the living cells are made up of protein, which acts as building blocks for every organism. These…

Q: Describes an anti-codon?

A: According to Central Dogma :- Genetic instructions are transferred from DNA to RNA and then RNA to…

Q: Which of the following best describes a stop codon?

A: Stop Codons constitute of three nucleotide sequence of m-RNA that doesn't code for any amino acid.…

Q: For translation, identify two things that happen during each step - initiation, elongation and…

A: Translation is a complex process it is the final formation of protein with the help of m RNA, t RNA…

Q: Which events during translation involve molecular recognition between base sequences within…

A: Introduction The process of formation of protein from the mRNA is termed as Translation.…

Q: Given that out of the 64 codons of MRNA, 61 codify amino acids that form polypeptide chains, what…

A: As there are 20 amino acids and 64 possibilities of mRNA codons. There it is expected some amino…

Q: What is RNA transcript?

A: Ribonucleic acid is the macromolecule that is composed of ribose sugar, a phosphoric acid group, and…

Q: What is the result of Frameshift mutations from the insertion or deletion of nucleotides within the…

A: Mutation, an alteration in the genetic material of a cell of a living organism or of a virus that is…

Q: Can the same enzyme esterify more than one amino acid to its corresponding tRNA?

A: Aminoacyl transferases are the enzymes which are responsible for the attachment of the main acid to…

Q: What Determine the amount of mRNA that is available for translation ?

A: A single-stranded RNA molecule called messenger RNA (mRNA) is complementary to one of a gene's DNA…

Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation?*

A: A termination codon or a stop codon is a group of three amino acids that is present in the mRNA that…

Q: Describe the differences in translation initiation between prokaryotes and eukaryotes?

A: Translation in terms of biology refers to the process by which the RNA (ribonucleic acid)…

Q: A sequence of mRNA is mutated such that there is no "start" codon. Which of the following is a…

A: The ribosomal binding on the mRNA requires the presence of Shine Dalgarno or kozak sequence upstream…

Q: Which of the DNA strands is used in transcription?

A: Step 1 Transcription is the formation of RNA (ribonucleic acid) over the template DNA. It generates…

Q: Why is it essential that tRNA binds to both amino acids & mRNA codon during protein synthesis?

A: Protein synthesis involves translation of mRNA into a protein that requires three complex stages,…

Q: The amino acid sequence for a short peptide is Tyr-Leu-Thr-Ala. What are the possible base sequences…

A: Gene expression is the process by which information from a gene is used for synthesizing of a…

Q: Arrange the following steps in correct sequence. Translation 1. Formation of the peptide bond 2.…

A: The nucleotide is the most fundamental component of nucleic acids. The polymers RNA and DNA are made…

Q: Why is a mutation of a base in a DNA sequence much more serious than a mutation in a transcribed…

A: Replication is considered as the process, during which DNA is replicated into DNA, which is after…

Q: specific base pairing essential to the processes of transcription and translation?

A: Transcription is the process by which an RNA copy of a gene sequence is created. This copy, known as…

Q: If the base sequence of a segment of a molecule of DNA is changed, will the base sequence of the…

A: The genes are segments of DNA that contain hereditary information. Some part of this gene is…

Q: 43/ 50 Which of the following molecular structures contan codons? A a protein B mRNA CIRNA DIRNA EB…

A: Introduction :- A codon is a three-nucleotide DNA or RNA sequence that serves as a unit of genomic…

Q: What amino acid sequence is coded for by the mRNA base sequenceCUC-AUU-CCA-UGC-GAC-GUA?

A: The sequence of a protein is notated as a string of letters, according to the order of the amino…

Q: Which of the following is an RNA nucleoside?

A: Nucleosides- these are the compounds which contains only sugar and base and no phosphate groups are…

Q: What is the meaning of translation in molecular biology?

A: The literal meaning of translation is conversion of data from one language to another. This is the…

Q: Define the mutations of the second base of triplet codons ?

A: Alteration of single base pair is called as point mutation. Point mutations can have one of three…

Q: Which statement is true regarding the number of start (initiation) and STOP codons in the standard…

A: Genetic code carries the information present in mRNA in the form of nitrogen bases, for the…

Q: if mRNA has a codon sequence of 5'-UAG-3', it will encode: Ieucine, no amino acide, methionine, a…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum create…

Q: what happens if a mutation causes a tRNA to be charged with the wrong amino acid?

A: Any permanent change or alteration occurred in the DNA sequence is termed as the genetic mutation.…

Q: Describe the steps of translation initiation,elongation, and termination.

A: Introduction:- The process of forming a polypeptide chain from mRNA codons is known as translation…

Q: During the initiation of translation in bacteria, the small ribosomal subunit binds to which…

A: Translation occurs after the transcription in which genetic information is copied from DNA to RNA.…

Q: Define the terms codon and anticodon, and list three start and stop codons.

A: Codon and Anticodon plays an significant role in the transcription and translation of the DNA and…

Question

c) A gene in a bacteria has the following DNA sequences (the promoter sequence is
positioned to the left but is not shown):
5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3'
3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5'
i) By referring to the codon table below, write the corresponding mRNA transcript and
polypeptide translated from this DNA strand.
2
Second letter
с
A
G
UUUPhe
UUC
UUA
UUG Leu
UCU
UCC
UCA
UCG
UAU Tyr
UACS
Ser
UAA Stop UGA Stop A
UGU
UGC
UAG Stop UGG Trp G
CAUTHIS
CAC
CAA Gin
CCU
ССС
CUU
CỤC
CUA
CUG
CGU
CC
Arg
Leu
Pro
ССА
CGA
A
CCG)
CAG.
CGG
G
AAU
AGU ser
AUU
ACU
Asn
AAC.
AUC Fle
AUA
AUG Met ACG
АСC
AGC
AGA Arg
Thr
ACA
AAA
AAGLYS
AGG
GAU
Asp
GAC.
GGU
GGC
Gly
GUU
GCU
GỤC
Val
GUA
GCC
Ala
GCA
GAA1
Glu
GAG.
GGA
GUG
GCGJ
GGG
G
ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that
resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence
following transcription and translation?
First letter
DUAG
Third letter

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Answer and explanation

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the preceding
The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made
An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bp
The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?
What will be the overall anti-codon sequence in tRNA for this mRNA? 5’-GUAGCCUUAUCUAGCGAUCACCGUCCGUAUUACUAGUGGCCAGACUCUUUUCACCAUGUAUAGUUG-3’
The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ How many amino acids are in the peptide encoded by the gene? _____________
The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ Draw boxes around any structures or bases that were added to the RNA during processing.
The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?
Translate the following mRNA into protein, starting from the first initiation codon: 5'-CCGAUGCCAUGGCAGCUCGGUGUUAC AAGGCUUGCAUCAGUACCAGUUUGAAUCC-3'
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.