data frame of values is in screenshot-6 columns and 6 rows (can call it df) question python code to plot the six sets of row values of data frame df in separate graphs using subplots

Python code not working, please check my code. Here is the question it is based off: Building and using DNA Motifs Background Sequence motifs are short, recurring (meaning conserved) patterns in DNA that are presumed to have a biological function. Often they indicate sequence-specific binding sites for proteins and other important markers. However, sometimes they are not exactly conserved, meaning some mutations can happen in a motif in a particular organism. Mutations can be DNA substitutions/deletions/insertions. Therefore, sequences are usually aligned and a consensus pattern of a motif is calculated over all examples from organisms. The following are examples of a transcription factor binding (TFB) site for the lexA repressor in_ E. Coli _located in a file called lexA.fasta: >dinD 32->52 aactgtatataaatacagtt >dinG 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca…