Directions: Transcribe the following strand into mRNA, then translate it into amino acids Example DNA TACAAAAACAAGGTAACGGTCATC mRNA AUGUUUUUGUUCCAUUGCCAGUAG AA Start-Phe-Leu- Phe-His-Cys-Gln-Stop DNA TAC-CTA-CTC-ATA-GAT-CTG-CTT-ATC mRNA AA :: GAU :: UAU :: UAG :: Methionine (Start) :: GAG :: Leucine :: Stop :: Tyrosine :: AUG :: GAA :: Glutamic Acid :: CUA :: GAC :: Serine :: Glycine :: Aspartic Acid

Directions: Transcribe the following strand into mRNA, then translate it into amino acids Example DNA TACAAAAACAAGGTAACGGTCATC mRNA AUGUUUUUGUUCCAUUGCCAGUAG AA Start-Phe-Leu- Phe-His-Cys-Gln-Stop DNA TAC-CTA-CTC-ATA-GAT-CTG-CTT-ATC mRNA AA :: GAU :: UAU :: UAG :: Methionine (Start) :: GAG :: Leucine :: Stop :: Tyrosine :: AUG :: GAA :: Glutamic Acid :: CUA :: GAC :: Serine :: Glycine :: Aspartic Acid

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
Translate the RNA codons using the given genetic code 5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'
Translate the mRNA into a protein using the genetic code. (Amino acid chain.) AUG( met)-UUU( Phe)-GUA( Val) - CAU (his)-UUG(leu) -UGU(cys)- GGG(gly)- AGU(ser)- CAC (his) - CUG(leu) GUU(Val)- GAG (Glu)-GCG(ala)- UUG(Leu)- UAU(tyr)- UUG (leu)-GUU(Val)- UGU(cys)- GGC(gly)-GAG( Glu)-CGC(arg) - GGC(gly) - UUU(phe) - UUC(phe).
UCA CAG AAA CUG How many amino acids does the mRNA strand above code for?
Complete the complementary strand: mRNA transcription ATTCGAGGCTAA
1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' GCC-AUG-GUA-AAA-UGC-GAC-CCC 3' 2. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence 5' CAU-CCU-CAC-ACU-GUU-UGU-UGG 3'
Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop sequences. UGCGAUGGCAAUCGGUGUACCCCUGACUGAGC
Translate the following mRNA into protein, starting from the first initiation codon: 5'-CCGAUGCCAUGGCAGCUCGGUGUUAC AAGGCUUGCAUCAGUACCAGUUUGAAUCC-3'
DNAT A C C G C T C C G C C G T C G A C A A T A C C A C T mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______
Transcribe the corresponding mRNA strand from the given DNA strand: DNA: TAC GCA CCC AGC CTA TCC GTC ATT mRNA: Complete the corresponding DNA strand from the mRNA strand: DNA: mRNA: AUG ACU GCG CCC CGA UCC UGU UAA Translate the following mRNA sequence into its appropriate amino acid sequence: (abbreviate amino acids by first three letters. Example: Methionine abbreviates to MET mRNA: AUG CUU AGC ACU GUU GAU UAU UCG Given the amino acid sequence, complete a possible DNA strand that compliments the strand: DNA: mRNA: Amino Acids: Met – Lys – Pro – Arg – Ser – Leu - STOP
State if the DNA is written 5' to 3' or 3' to 5' Transcribe the sequence. Include the 5' and 3' Translate the sequence (codon chart included) +1 TAGTCCAAAGGTTTACGTAAATGGGATGTCGAAATTGACTAGATCA