After Heat the mixture to separate mRNA and cDNA strands, and then eliminate the mRNA transcript. The 3’ ends of the cDNA strands loop around and bind by chance to complementary nucleotides within the same strand, forming a “hairpin loop” that serves as the primer for DNA polymerization, what is step 4 of making a cDNA library?

After Heat the mixture to separate mRNA and cDNA strands, and then eliminate the mRNA transcript. The 3’ ends of the cDNA strands loop around and bind by chance to complementary nucleotides within the same strand, forming a “hairpin loop” that serves as the primer for DNA polymerization, what is step 4 of making a cDNA library?

Name: After Heat the mixture to separate mRNA and cDNA strands, and then eli
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: After Heat the mixture to separate mRNA and cDNA strands, and then eliminate the mRNA transcript. The 3’ ends of the cDNA strands loop around and bind by chance to complementary nucleotides within the same strand, forming a “hairpin loop” that serves

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 4P: Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram...

See similar textbooks

Similar questions

Polymerases usually add only about 10 nucleotides to a DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands of nucleotides at a moving fork. How is this addition accomplished?
Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands ofnucleotides at a moving fork. How is this additionaccomplished?
RNA polymerase from E. coli (core enzyme alone) has all of the following properties except: a)requires all four ribonucleoside triphosphates and a DNA template. b)can extend an RNA chain and initiate a new chain. c)recognizes specific start signals in DNA. d)produces an RNA polymer that begins with a 5'-triphosphate. e)is required for the synthesis of mRNA, rRNA, and tRNA in E. coli.
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =
It was once thought that the DNA polymerase machinery moves along DNA in a manner analogous to a train on a track. Current evidence indicates that the polymerizing machinery is instead stationary and that the DNA strands are pumped through the complex. What advantages does this stationary mechanism have?
Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second in human cells and origins of replication occur every 300 kbp. Assume also that human DNA polymerases are highly processive and only two molecules of DNA polymerase arc needed per replication fork. How long would it take to replicate the entire diploid human genome? How many molecules of DNA polymerase does each cell need to carry out this task?
Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.
Discuss Concepts A forensic scientist obtained a small DNA sample from a crime scene. In order to examine the sample, he increased its quantity by cycling the sample through the polymerase chain reaction. He estimated that there were 50,000 copies of the DNA in his original sample. Derive a simple formula and calculate the number of copies he will have after15 cycles of the PCR.
Histones and DNA polymerase subunits are both synthesized in the cytosol but they function in the nucleus: histones in packaging DNA and the polymerase in replicating DNA. How are they imported into the nucleus? Compare the import process for histones to that for DNA polymerase subunits.
Genome Assembly with Perfect Coverage and Repeats Given a list of error-free DNA 3-mers taken from the same strand of a circular chromosome. Find all circular strings assembled by complete cycles in the de Bruijn graph B2. Find the circular chromosome sequence. Dataset: ATC ATG CAT CCA GAT GGA TCC TGG
"DNA repair mechanism all depend on the existence of two copies of the genetic information, one in each of the two homologous chromosomes" is true or false.
Shown below is a long template strand of DNA where lagging strand DNA synthesis is occurring. The short horizontal lines represent two Okazaki fragments that have already been made. In the context of the replication fork, select the letter(d–g) that indicates where primase will synthesize the next RNA primer. Explain why did you choose that location?