ebitgeqyloq erl to noihoq ertt qu 9lem bluow iert ebios onime et enimalsbnworlellew as yes TOi noitemoini ebulonlelelgmst AMO3. The following MRNA strand is being used to assemble a polypeptide strand by aribosome: 5'-AUGCUUGCUCAUCGGGGUUUUAA-3'AHR(a) Write out the amino acids that will be assembled, in their correct order.(b) Provide an alternative MRNA sequence with four or more changes that wouldtranslate to the same amino acid sequence.

Name: ebitgeqyloq erl to noihoq ertt qu 9lem bluow iert ebios onime et enim
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: ebitgeqyloq erl to noihoq ertt qu 9lem bluow iert ebios onime et enimalsbnworlellew as yes TOi noitemoini ebulonlelelgmst AMO3. The following MRNA strand is being used to assemble a polypeptide strand by aribosome: 5'-AUGCUUGCUCAUCGGGGUUUUAA-3'AHR(a

Given: An mRNA strand is given and we need to find A. Respective amino acid sequence. B. Alternative…

Science

Biology

elelgmst AMO 3. The following mRNA strand is being used to assemble a polypeptide strand by a noit holighotned ribosome: 5'-AUGCUUGCUCAUCGGGGUUUUAA-3' (a) Write out the amino acids that will be assembled, in their correct order. (b) Provide an alternative mRNA sequence with four or more changes that would translate to the same amino acid sequence.

elelgmst AMO 3. The following mRNA strand is being used to assemble a polypeptide strand by a noit holighotned ribosome: 5'-AUGCUUGCUCAUCGGGGUUUUAA-3' (a) Write out the amino acids that will be assembled, in their correct order. (b) Provide an alternative mRNA sequence with four or more changes that would translate to the same amino acid sequence.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 13P

See similar textbooks

Similar questions

Complete the complementary strand: mRNA transcription ATTCGAGGCTAA
Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
TACTCACCCCGTATTACGTTT What’s the MRNA Protein Phenotype
Translate the mRNA into a protein using the genetic code. (Amino acid chain.) AUG( met)-UUU( Phe)-GUA( Val) - CAU (his)-UUG(leu) -UGU(cys)- GGG(gly)- AGU(ser)- CAC (his) - CUG(leu) GUU(Val)- GAG (Glu)-GCG(ala)- UUG(Leu)- UAU(tyr)- UUG (leu)-GUU(Val)- UGU(cys)- GGC(gly)-GAG( Glu)-CGC(arg) - GGC(gly) - UUU(phe) - UUC(phe).
Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT
What's the tRNA strand for the following mRNA strand: AUGGCUAACCUUGUA
A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.
Explain The mRNA codon of valine is: GUC UGG CCA TTG
3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’ 5’-AGAAGCACTCTACTATATTCTCAATAGGTCCATGGCCATTTGACC-3’ Write down the mRNA transcript from DNA above.
Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________
The following is a strand of mRNA:CAA GUG AAA ACAHow many amino acids does the mRNA strand above code for?
A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the DNA cause aprotein change in sequence fromPhe–Ser–Pro–Arg–Leu–Asn–Ala–Val–LystoPhe–Val–His–Ala–Leu–Met–Ala–Val–Lysa. What are the old and new mRNA nucleotide sequences? (Use the codon dictionary in Figure 9-5.)b. Which nucleotide has been added? Which has beendeleted?