Enzymes act by: a. increasing the activation energy for a reaction b. lowering the activation energy for a reaction c. increasing the free energy of the system d. decreasing the free energy of the system
Q: Think about ONE possible consequence with a brief explanation if the primers were not removed after…
A: Introduction: DNA is a genetic material that defines every cell. Before a cell duplicates and is…
Q: True or False? a. An excess of amino acids can result to the destruction of proteins.
A: The destruction of proteins in cells can occur when due to misfolding and aggregation of proteins…
Q: The picture below shows the body's response to acute stress, which is to release adrenaline…
A: Introduction: Adrenergic neurons release norepinephrine as the primary neurotransmitter. These…
Q: Draw a linear disaccharide of glucose. is an alternating alpha (1-4) and b (1-4) linkages energy…
A: Introduction:- The question is all about the structure of glucose that are isomers of each other as…
Q: Explain the four stages of biochemical energy production from food which are part of the typical…
A: The which we consume is composed of nutrients like carbohydrates, proteins, and lipids. After…
Q: What is the detection principle of iodine test for starch
A: The iodine test is a quantitative analysis of carbohydrates to distinguish polysaccharides from…
Q: Question 4 Match the following descriptions to the given choices v Synthesized from a steroid…
A: A vitamin is an organic molecule which is an essential micronutrient for organism and are needed…
Q: 4. During a lunch at a McDonald's outlet, an office employee received about 350 g of carbohydrates…
A: for you. If you want a specific question to be answered then please specify the question number or…
Q: A 2x10-6 dilution of your bacterial culture yielded 10 colonies. What was the cell density (in…
A: The purpose of dilution of the bacterial culture before plating is to ensure that the cells are are…
Q: What is enzyme specificity?
A: The metabolic processes involve several metabolic pathways each with several chemical reactions…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: production of Ribose 5-phosphate in the Pentose Phosphate Pathway is needed in the synthesis of…
A: Pentose phosphate pathway, also called the hexose monophosphate shunt or phosphogluconate…
Q: How does 2, 4 Di Nitro Phenol raise human body temperature when used in a weight-loss program?
A: 2,4-Dinitrophenol (DNP) is a yellow, crystalline substance with a sweet, musty odour. It sublimes,…
Q: A 1% by weight agarose gel is typically used in agarose gel electrophoresis. If you used a 2%…
A: During agarose gel electrophoresis, an agarose solution is prepared, it is cooled to prepare a gel,…
Q: if they are true or false? Kindly leave a short explanation. Many thanks! 1. Unlike carbohydrates…
A: A biomolecule, also known as a biological molecule, is one of the many compounds created by cells…
Q: Design a quantitative research experiment to investigate the influence of pH or temperature on the…
A: Introduction: Enzymes are biological catalysts that fasten the speed of the chemical reaction. They…
Q: Why is it difficult to accurately estimate Km and Vmax values from a Michaelis-Menten plot…
A: The rate of enzyme catalyzed reaction that is the enzyme kinetics can be expressed by the…
Q: Look at the structure of the disaccharide shown. Name the type of bond which is present. CH2OH H он…
A: Disaccharides exist in more than one chemical conformational structure. The alpha and beta forms of…
Q: When left untreated, very high levels of plasma growth hormone always lead to either gigantism or…
A: 1. True 2. True 3.True(Rarely metastatic)
Q: Match the following descriptions to the given choices. A. Aldosterone The first molecule in the…
A: Steroids are biologically four ringed organic compounds that act as important components of cell…
Q: What is the most common type of DNA sequence present in eukaryotic genomes? A. Repetitive DNA…
A: B. Minisatellites - Micro- and mini-satellites, as well as satellite DNA sequences, account for…
Q: Nutrition Facts Calories 112 Total Fat 0g Total Carbohydrates 21 g Protein 7g What percentage of the…
A: Introduction: Calories are the amount of energy or heat that takes to raise the temperature of one…
Q: Procedure: 1. Dissolve one teaspoon or one packet of active yeast in a small amount of warm water.…
A: Hi, thanks a lot for submitting multiple questions and as you have asked to answer 5, 6 and 7…
Q: 1. Of which of these do your cells have the least of? A. MRNA B. FRNA C. TRNA D. NDNA E. Proteins 2.…
A: Cells are composed of different components, cell organelles and molecules that are responsible for…
Q: Create your own timeline form on biochemistry development and its discovery until today
A: Introduction: The study of the molecular basis of life or understanding the life phenomenon in…
Q: What is the role of the prep phase in glycolysis? To convert G3P molecules into pyruvate and produce…
A: In glycolysis, the glucose molecules are broken down into two molecules of pyruvate along with the…
Q: Calculate the number of ATPATP generated from one saturated 1212‑carbon fatty acid. Assume that each…
A: Fatty acids are broken down through beta-oxidation in mitochondria. The end product of…
Q: HomeExpert Q&AMy answers How is serine related to the activated methyl cycle? Serine’s side chain…
A: Serine is a non-essential amino acid. It is a glucogenic amino acid. Serine undergoes deamination…
Q: Write an equation to describe the catabolism of an aerobic hydrogen oxidizer
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: 1 Suppose that you have 1ml of a buffer solution with a pH of 6.8 and you add 1ml of 2% starch…
A: Salivary amylase is an enzyme that works on catalytic digestion of starch. Salivary amylase…
Q: Question 1 -- / 1 Where does molecular oxygen (O2) get generated during photo-phosphorylation? 1…
A: The plants use light energy to convert CO2 and H2O into sugars and oxygen. So, photosynthesis is the…
Q: Given Raffinose, Briefly explain its expected reaction (based on their structural formula) to the…
A: Raffinose is a trisacharide made by three monosacharide units galactose Glucose and fructose.…
Q: How does NH4SO4 affect water structure? What does this have to do with protein solubility? I thought…
A: One of the factors that determine the solubility of proteins in solution is the concentration of…
Q: What is the dna strand sequence for phosphate sugar backbone?
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Give the 3 major pathways that eventually become entry points of molecules into the Krebs Cycle.…
A: The Krebs cycle, or citric acid cycle, occurs in the mitochondrion of a cell. The citric acid cycle…
Q: 1. What are the major functions of lipids?
A: Introduction: Lipids are a heterogeneous group of biological compounds which includes fats, oils,…
Q: Second messenger in regulation of metabolism is: Select one: O a. hormones Оb. АТР neurotransmitters…
A: Secondary Messengers are the molecules that act as amplifying components in the cell signalling and…
Q: Please explain what happened in the reaction. How did H2SO4 and 3H2O reacted with the glucose?
A: Carbohydrates are polyhydroxy aldehydes or ketones or compounds that yield them on hydrolysis.…
Q: Which of the following statements are correct about how the complex biological matrix of the cell…
A: cell matrix or the cytosol is the fluid component of the cell which contains many organelle that…
Q: The purpose of the carbohydrate in the food industry and its frequency of use
A: A carbohydrate is a biomolecule made up of carbon (C), hydrogen (H), and oxygen (O) atoms, with a…
Q: Insulin Glucagon Glycolysis Hexose monophosphate pathway Gluconeogenesis Glycogenolysis
A: Insulin is a hormone made by our pancreas. It controls the amount of glucose in our bloodstream at…
Q: 9. It is noted recurrent vomiting, weakness, sleepiness, and convulsive attacks, as well, in…
A: The ureotelic organisms are the organisms, which convert the ammonia formed through protein…
Q: Which amino acid(s) are more commonly found at the At which position(s) are amino acids limited to…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Which mayonnaise is thicker? Mixing oil to the mixture gradually or mixing all the ingredients in?…
A: Mayonnaise is a condiment used in burgers, salads, and sandwiches. Mayonnaise is considered as a…
Q: Which of the following enzyme catalyzes the first step of glycolysis? Group of answer choices…
A: Glycolysis : Process in which the glucose gets broken to produce pyruvate, ATP, NADH and water.
Q: When human hemoglobin undergoes a mutation, the mutant protein usually does not replace all of the…
A: The cytosol of red blood cells contains the oxygen-carrying globular protein hemoglobin, which is…
Q: 10. Messenger RNA often encodes more that one biological activity. These activities can then be…
A: Introduction: Messenger RNA (mRNA) is a single-stranded RNA that carries hereditary information from…
Q: 2. ( To the right is a schematic diagram of His the active site in the Michaelis complex of a-chy-…
A: Chymotrypsin is a protease that cleaves a peptide at the C-terminal of all aromatic amino acid.…
Q: 4. Why is the type of cell (aerobic/ anaerobic) important to the purpose of this enzyme?
A: Enzymes are highly efficient biological catalysts that speed up metabolism or the chemical reactions…
Q: 5. A young woman decided to lose weight and abstained from fat-containing food for several months.…
A: "Since you have asked multiple questions, we will solve the first three subparts of the question for…
Step by step
Solved in 2 steps
- Modified true or false. If false, replace the underlined word with the correct answer.Instructions- DO THE GRAPH LABELING THE NUMBERS AND LABELING THE POINTS AND PLEASE DO THEM ON THIS PICTURE NO HANDWRITTEN-THAWING- please answer as soon as possible thank you and kindly please make it possible for 3-4 sentences? What is the effect of subsequent thawing and freezing to the texture of ice cream?