2. ( To the right is a schematic diagram of His the active site in the Michaelis complex of a-chy- motrypsin and a polypeptide substrate. Describe briefly the catalytic or structural roles of the residues listed below: но— Ser 195 (a) Ser195 AAn-C-CH-NH- CH-NH -AAn R H. Gly 193 Ser193 (b) His57 (c) NH groups of Gly193 and Ser195 (d) The most favorable side chain R for binding (e) Identify the scissile bond with an arrow, i.e., the bond in the peptide substrate that is cleaved as a result of the catalytic action of the enzyme. You can point to it on the diagram above.
Q: The fact that some eukaryotic rRNAs are self-splicing indicates that (A RNA can contain modified…
A: When transcription of DNA to RNA happens the introns are removed either by the RNA itself or by a…
Q: Which of the following glycosidic linkages is hydrolyzed by the a-amylase?
A: α amylase enzyme belongs to the enzyme group of amylase. Amylases hydrolyses the α-1,4-glycosidic…
Q: RI `R? OH
A: DAG is an important lipid it can act as signaling lipid or intermediate in biosynthesis pathway,
Q: Rory’s father was working on the electrical wiring his basement. Rory noticed that his father wore…
A: Rory's father was wearing rubber gloves, which are known to be one of the defense mechanisms while…
Q: COMPLETE THE TABLE OF 10 STEP OF GLYCOLYSIS BY REFERRING TO THE GLYCOLYSIS PATHWAY
A: The chemica; interconversion steps, that is the sequence of reaction by which glucose is converted…
Q: In generating CO2, how can the citric acid cycle discriminate between the carbons in citrate given…
A: In the first phase of the citric acid cycle, acetyl CoA combines with oxaloacetate, a four-carbon…
Q: Which of the following condition is NOT associated with riboflavin deficiency? * (Please choose one…
A: Riboflavin is a water soluble vitamin. It is also called as B2 vitamin. Foods like pork, eggs,…
Q: Enzymatic digestion of carbohydrates starts in the mouth. True False
A: Enzymatic digestion is generally referred to as the act of breaking down ingested food materials,…
Q: 2. Glvcolate is oxidized into Glvoxylate by cytochrome Cusing the glycolate oxidase enzyme, The two…
A: Glycolate oxidase is a key enzyme involved in the conversion of glycolate to glyoxylate during…
Q: 7. A 22-year-old patient suffering argininosuccinic aciduria from little was prescribed the…
A: Arginosuccinic aciduria is a genetic disorder of the urea cycle. a) Scheme of ammonia…
Q: 18:3CA9,12,15
A: Alpha Linolenic acid is essential fatty acid, highly concentrated in plant oils. Essential fatty…
Q: a. Name the phosphoinositide generated through the action of PI-5 kinase. b. Name the products…
A: Phosphatidylinositol (PI)-related signalling is important for survival, cell proliferation,…
Q: The first loss of carbon in the metabolism of glucose takes place as CO2, in the formation of…
A: Glucose metabolism occurs in three stages. They are 1) Glycolysis 2) TCA cycle 3) Oxidative…
Q: Explain the biochemical and subsequent medical consequences of a deficiency of Myoadenylate…
A: Myoadenylate deaminase insufficiency is a metabolic muscle disorder in which the muscle cell's…
Q: Show the amount of ATP were produced in beta-oxidation of lauric acid, and differentiate both the…
A: Lauric acid has a 12-carbon backbone and is a saturated medium-chain fatty acid. Under anaerobic and…
Q: In a glucometer, glucose oxidase catalyzes the redox reaction of glucose to form gluconolactone.…
A: A glucometer is generally a little, portable device that helps to monitor (glucose levels) at home.…
Q: Pioglitazone, a drug used to treat diabetes, causes some membrane-embedded portions of mitochondrial…
A: Complex I is the largest multi-subunit complex of Mitochondrial Respiratory Chain (MRC), that causes…
Q: Paracelsus is famous for saying that “all substances are poisons; there is none which is not a…
A: Poisons are chemicals that have the potential to kill. They are chemicals, either man-made or…
Q: malate + NAD+ oxaloacetate + NADH + H+ If the pH = 7 and [malate] = 0.0010 M, [oxaloacetate] =…
A: Malate + NAD+ →Malate dehydrogenase Oxaloacetate + NADH + H+ Above reaction is the last step of…
Q: b. Two different liposomes have radii of 50.00 nm and 70.00 nm respectively. In a biopolymer…
A: Introduction: Liposomes are simple microscopic vesicles in which aqueous volume is enclosed entirely…
Q: Explain the 4 roles of enzymes thereby lowering the activation energy
A: An enzyme, by definition, is a protein molecule that acts as a biological catalyst, allowing…
Q: 8/9 Instructions; • Answer the Question properly and accordingly. • Do not copy here in Bartleby or…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Enumerate the main structural features of nucleosides and nucleotides
A: There are 4 biomacromolecules; protein, carbohydrate, lipid and nucleic acids. In these, nucleic…
Q: ng glycolysis, t
A: Disclaimer: “Since you have asked multiple question, we will solve the first question for you. If…
Q: Bradford technique makes use of the Coomassie blue dye that binds to the protein, with the complex…
A: Coomassie blue is disulphamide triphenyl methyl compound.Coomassie dye binds to proteins through…
Q: KOH required to neutralize fatty acid present in 1 g
A: Some alkali bases, such as potassium hydroxide KOH, combine with fatty acids, lipids, or oil…
Q: Match lipid descriptions in column A with the phospholipid types in column B. H is attached to the…
A: Phospholipids are found in the membrane. Their structure comprises of polar head group &…
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase…
A: Glucose is converted to pyruvate through the process of glycolysis in the cytoplasm. The process of…
Q: Substrate A occupies the active site of an enzyme. However, inhibitor XY occupies a region in the…
A: Enzymes are catalyst which only accelarate the reactions but doesn't take part in reaction. So after…
Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…
A: DNA strand given here with directionality is as: 5’…
Q: Which of the following glycosidic linkages is hydrolyzed by the α-amylase? α(1,6) α(1,4)…
A: The monosaccharide units of oligosaccharides and polysaccharides are linked together through the…
Q: 1) If a mutation caused an alanine to turn in glycine, what kind of effect do you think that would…
A: Alanine: An aliphatic amino acid with methyl (-CH3) group side chain and is non-reactive side chain…
Q: Glucose are stored in the form of glycogen and any excess will be stored in the form of…
A: Glycogen is multibranched polymers of glucose and it is storage form of carbohydrates in mammals.…
Q: Match the following: choices: transcription factor
A: Transcription is the process of synthesizing RNA from genetic information stored in DNA. There are…
Q: Functional group as indicated by letters A,B,C and D?
A: Tamiflu is a drug made from the starting molecule shikimic acid. Tamiflu is a prodrug usually used…
Q: Match lipid structures in column A with its lipid type in column B esters of fatty acids with long…
A: The question include match the following with different options. The correct options are mentioned…
Q: A peptide was cleaved into two smaller peptides with cyanogen bromide (CNBr) and into two different…
A: The given peptide sequences are: CNBr 1: Gly-Thr-Lys-Ala-Glu CNBr 2: Ser-Met Tryp 1:…
Q: Which statement is true about GLUT1? GLUT1 transports glucose into erythrocytes against a…
A: Glucose transport is carried out by different transporters which are expressed in different forms in…
Q: When can we say that it is an essential amino acids and non essential amino acid? Choose two amino…
A: Introduction: Amino acids are biomolecules that contain an amino and a carboxyl group-containing a…
Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 9. How are Okazaki…
A: Okazaki fragments : These are pieces of DNA which are the transient components of the lagging strand…
Q: Aspartic acid has a side chain bearing a carboxylic acid group; its pKą is ~4. The alpha-carboxylic…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: a. list the proteins in the order of first to the last that eluted 6. list the proteins in the order…
A: Proteins are composed of amino acids with specific molecular weight and pI (isoelectric point).…
Q: In kappa and iota carrageenans, gels are formed through double helical formation of two…
A: Carrageenans are polysaccharides comprised of repeating disaccharide units of sulfate derivatives…
Q: 4. A solution containing egg albumin (pl-4.6), B-lactoglobulin (pl-5.2), and chymotrypsinogen…
A: Based on their isoelectric point, protein purification can be done in an ion-exchange column (pI).…
Q: 1. What is the effect of increasing the concentration of lactose in the action of the enzyme…
A: "Since you have posted multiple question, we will answer the first question for you. If you want any…
Q: These are enzymes that can sustain in a high hydrostatic pressure. * (Please choose one correct…
A: Bacteria are classified into different classes based on the influence of different environmental…
Q: 2 Two version of the same enzyme were isolated, a wild type and a mutant differing at a single amino…
A: Enzymes are protein molecules that increase the rate of reaction by decreasing the activation…
Q: Based on the figure and the explanation in the textbook, what are the random chances that the…
A: Denaturation is the process by which proteins lose their native conformation. Ribonuclease A has 124…
Q: What is the general definition of an uncoupler protein? In the context of oxidative phosphorylation,…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: I. Effect of pH on ezyme activity pH Test tube Observation I 2 4 4 5 12 Conclusion: 8. 3.
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- 6 (a) A decapeptide has the following amino acid composition: Ala2 , Arg, Cys, Glu, Gly, Leu, Lys, Phe, Val Partial hydrolysis yields the following tripeptides: Cys-Glu-Leu + Gly-Arg-Cys + Leu-Ala-Ala+ Lys-Val-Phe + Val-Phe-Gly. Reaction of the decapeptide with 2,4-dinitrofluorobenzene yields 2,4-dinitrophenylysine. From the experimental data, deduce the primary structure of the decapeptide. (b) Suggest a scheme you will follow to synthesize the dipeptide Ala-Gly3CLpro is a cysteine protease, which are among the most common proteases in biochemistry, however they are a structurally diverse family of enzymes especially in the organization of the active site amino acids. A group of scientists have reported a potential drug molecule based on a binding study using circular dichroism. They report that the molecule binds to the active site. Can the experiment support the claims, why or why not? Which techniques might be used to support this claim?1. Acid phosphatases are an important group of enzymes that can be detected in human blood serum.Under slightly acidic conditions (pH 5.0), this group of enzymes can hydrolyze biological phosphate esters as follows: R-O-P-O3-2 + H 2O R-OH + HO-P-O3-2. Acid phosphatases are produced and can be detected in erythrocytes, kidney, spleen, the liver, and prostate gland. The enzyme from the prostate gland is clinically important because an increased activity in the blood is frequently an indication of cancer of the prostate gland. Tartrate ion can strongly inhibit the phosphatase from the prostate gland, but not acid phosphatases from other tissues. How canyou use the information above to develop a specific procedure for measuring the activity of the acid phosphatase of the prostate gland in human blood serum?
- #1 Specify the role each of the following amino acids play within the crystal structure and/or active site for Be as specific as possible, with pictures (and mechanistic arrows) as necessary. His11 Arg140 Glu89 Trp68 #2 Provide a step-wise mechanism for the reaction Bisphosphoglycerate mutase catalyzes, using the amino acids responsible for aiding in catalysis. You do not need to add surrounding amino acids that aid in substrate specificity. (drawn out)8. The chemical structure of Coenzyme A contains the following except— a phosphoanhydride moiety. a β-mercaptoethylamine residue. a lipoic acid residue. a pantothenic acid residue. an adenosine-3’- phosphate.Bovine chymotrypsinogen has a molecular massof 25.6 kDa. Amino acid analysis shows that thisenzyme is 4.7% Gly (Mr 75.1).b. Calculate how many glycine residues are present in amolecule of bovine chymotrypsinogen
- If D-glyceraldehyde-3-phosphate (DGAP) is dissolved in water, 96% of it will form dihydroxy- acetonephosphate (DHAP). Which of the following will triose phosphate isomerase do? a)Shift the balance to 100% DHAP b)Shift the balance to 0% DHAP c)Shift the balance to 50 DGAP : 50 DHAP d)Catalyze the peptide bond breaking e)Make the reaction faster4 How do I convert from DPM to picomoles per milligram of protein (pmol/mg)? I have the specific activity as [3H]-spiperone is 25530 DPM/pmol. is there an equation?1. The Fehling’s reaction, which is a simple assay for reducing sugars, was used as a diagnostic test for the determination of blood glucose concentrations for a very long time. However, it has now been replaced by the glucose oxidase test. The enzyme glucose oxidase isolated from the mold Penicillium notatum catalyzes the oxidation of β-D-glucose to D-glucono-δ-lactone. This enzyme is highly specific for the β-anomer of glucose and does not affect the α-anomer. In spite of this specificity, the reaction catalyzed by glucose oxidase is commonly used in a clinical assay for total blood glucose—that is, for solutions consisting of a mixture of β- and α-D-glucose. Explain how this is possible. Aside from allowing the detection of smaller quantities of glucose, what advantage does glucose oxidase offer over Fehling’s reagent for the determination of blood glucose? 2. Consider only the oxygen levels present in the cytoplasm and ECF as shown in the drawing above (no new oxygen is entering…
- In a mixed heteropolymer experiment, messages were createdwith either 4/5C:1/5A or 4/5A:1/5C. These messages yielded proteinswith the amino acid compositions shown in the followingtable. Using these data, predict the most specific coding compositionfor each amino acid.4/5C:1/5A 4/5A:1/5CPro 63.0% Pro 3.5%His 13.0% His 3.0%Thr 16.0% Thr 16.6%Glu 3.0% Glu 13.0%Asp 3.0% Asp 13.0%Lys 0.5% Lys 50.0% 98.5% 99.1%Histidine is frequently used as a general acid or base in enzyme catalysis. Considering the pKa value of the side chain, suggest a reason why is this so?#1)What are the main roles of the following amino acids; (within the crystal structure and/or active site. be specific, with pictures and mechanistic arrows as needed) -Glu305 from pyruvate carboxylase -Gln23 from Penecilin Acylase -Ser203 from Acetylcholinesterase #2) Why is L-tetrahydro-2-furoic acid would be a suitable inhibitor for Proline oxidase?