Experiment Isolation and Saponification:HNMR of isolated Trimyristin 500 100 B00 200 100 o ppm 10 ppm 5 ppm CDC13 F1.085 | 4.046 F6.155 - 68.57 F8.763

Q: 2. MF Relative Intensity 100- 80 40 20 0-|rrrrrr 25 -5 50 75 m/z 100 125 150

A:

Q: Humulin R U-100 insulin 30Units = ________ml

A: Interpretation-  To determine the volume of Humulin R U-100 insulin 30Units = ________ml -…

Q: Which of the following sequencing steps work best to convert toluene to meta-bromobenzoic acid? A.…

A: Aromatic compounds are susceptible for electrophilic or nucleophilic substitution reaction based on…

Q: Ex: A0.66 gram sample of L-(-)-menthof was dissolved in 13.3 mL of ethanol. The sample was then…

A:

Q: please

A: According to the question, we need to determine the correct answer for each of the statement.…

Q: 1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show…

A:

Q: Identify the structure of the important fragments. Show the arrow pushing mechanism to form the…

A: Introduction :  Infrared spectroscopy is technique to identify the functional group of the molecule.…

Q: Select which type of GC column is best suited to analyze a mixture containing o-xylene, m-xylene,…

A: The method of separating a compound which can be vaporized without the decomposition process and…

Q: (2) If equal weights of polymer A and polymer B are mixed, Calculate M, and M, of the m ixture…

A: Answer :-  1. Mn (Mixture) = 56722  2. Mw (Mixture) = 195000…

Q: 5. Show the step-by-step process. Do not use shortcut methods. Make it as detailed as it can be.…

A: Cahn – Ingold – Prelog system priority rules 1) Assign priorities as to the atoms or groups bonded…

Q: NaNH2 CH3-I H20 CH3-C=CH А B Hg2*, H*

A:

Q: bead resin with functional group R-CH2-SO3- will have highest relative capacity at pH ___.     8…

A:

Q: 2. provide a mechanism for the followinng sequence Etz0 Me, DH 2) AIC!3

A: An epoxide is a cyclic ring compound with an oxygen that constitutes the ring atom. The reaction of…

Q: Experiment Isolation and Saponification:HNMR of isolated Myristic Acid B00 200 100 10 ppm 5 ppm O…

A:

Q: 1. MF CH₂NO 100 Relative Intensity 80- 95 T 20- 0-m 25 50 tumum 75 100 125

A:

Q: Choice 141 - 0-12 snucoon 564 + 10-1 jinucieon 137 - 10-2 sinucleon 548 - 10- Jinucieon

A: According to the question, we need to determine the nuclear binding energy of potassium-40.  Given,…

Q: H. - Cr heat haffmann elimination Reoction

A: Given chemical reaction is Hoffmann elimination reaction. It is an elimination reaction in which a…

Q: LOD fpeak at ~3100 cm1 overlap 4000 3000 2000 1500 1000 SDO HAYENUMAERIal

A: the  IR spectrum of Furfuryl alcohal is given there

Q: 7-9

A: TLC is an analytical technique which can be used to monitor the organic reaction transformations.…

Q: MASS SPECTRUM 100. 57 (100%) 80. 60.- 40.- M 20.- 0. 20. 40. 60. 80. 100. m/z a. 3-methylpentane b.…

A:

Q: IR spectrum of maleic anhydride 100 80 - 60 40 20 - 4000 3600 3200 2800 2400 2000 1800 1600 1400…

A: Infrared spectroscopy is one of the convenient technique to visualize the functional groups present…

Q: Show the multistep synthesis

A:

Q: The negative ion mode electrospray ionization (ESI) mass spectrum of an oligonucleotide shows peaks…

A:

Q: 7.How many repeating units per molecule are there in each of the following cases: a) a sample of…

A: Number of repeating units: Teflon sample = 5000 units Polyvinyl chloride = 12000 units

Q: Provide a multistep synthesis.

A: The above transformation involves reduction of ester to form aldehyde, methylation at alpha position…

Q: Identify the structure of the important fragments. Show the arrow pushing mechanism to form the…

A: IR spectra deals results from the interaction of infrared radiation with matter by absorption. IR…

Q: 12. To see plant pigment extracts or pigments such as carotene on the TLC plate: a. One has to use…

A: Thin-layer chromatography is used to identify the product formed during the reaction or check the…

Q: 'H-NMR Data for Fisher Esterification with Unknown Alcohol Dynamite 3.5 3.0 1.5 1.0 ppm Zoomed area…

A: Here the product is n-pentylacetate. Here the alcohol is n-pentanol.

Q: The method used by TSA to detect organics is typically... O HPLC Absorption of visible light Mass…

A: The answer is  Mass Spectrometry

Q: Is it possible to extract benzoic acid using ethanol, instead of DCM, during solvent extraction?…

A: Solvent extraction is a technique in which the compounds are based on solubilities. In this…

Q: HO-

A: The complete synthesis for the reaction is given below :

Q: Hey, could you do q24 aswell?

A: The two reactant molecules are - carboxylic acid and an alcohol. H2SO4 acts as the catalyst whereas…

Q: Explain Retrosynthetic Analysis ?

A: Organic chemistry is about synthesis of the compounds. From simpler organic compounds to complex…

Q: What is the predominant form of EDTA at > pH 10.0?     HY3-     H2Y2     H3Y-      Y4-

A: At pH greater than 10, all the acidic Hydrogens of the EDTA will lost and remain negatively charged.

Q: If your sample gave you negative absorbance values during the kinetics run, what’s the most likely…

A:

Q: Identify the structure of the important fragments. Show the arrow pushing mechanism to form the…

A:

Q: Please answer only 4 and 5 Which us polyurethanes and epoxyresins

A: (4) Polyurethanes - polyurethanes are prepared by Reaction between polyol (more than one hydroxyl…

Q: OH I, GAg-Br D 2. Hz0 + Mg BIOH Synthesis i HC-Br Ms N D3HC-Mg-Br 2 3.

A: Formation of griganard reagent and nucleophilic addition to carbonyl compounds.

Q: quartet Off-resonance-decoupled singlet CDCI, (solvent) 200 150 100 50

A: The question is based on the concept of Spectroscopy. we have to interpret the spectra provided and…

Q: Show all possible fragmentations (show calculations). Mass Spectrum (simplified) Cpd: n-octane C3H18…

A:

Q: 9. Which of the following groups has the lowest priority according to the Cahn- ?Ingold-Prelog…

A: CIP rule is based on the atomic number of that atom which is attached to the stereogenic carbon…

Q: A student was trying to treat an alcohol with PCC and when they took the IR below they wanted to see…

A:

Q: Trial vol. of starch sol'n vol. of vol. of NazS203 diluted vol. of diluted vol. of K2S208 diluted…

A: It is required to calculate the concentration of the given compounds. The final volume of the…

Q: What mass spectral fragments are formed by α cleavage of butan-2-ol,CH3CH(OH)CH2CH3 ?

A: An analytical method which is used to identify the m/z ratio is known as mass spectroscopy. Here,…

Q: IR spectrum of maleic anhydride 100 80 - 60 40 - 20 - 4000 3600 3200 2800 2400 2000 1800 1600 1400…

A: Functionality present in a organic molecule can be well understood by using IR spectroscopy. By…

Q: Sodium acetate has a strong, sharp IR peak appearing at 1569 cm-1, as shown in the spectrum here. To…

A: The kind of stretching mode associated with the strong , sharp IR peak for sodium acetate in given…

Q: 'H-NMR Data for Fisher Esterification with Unknown Alcohol Dynamite it 3.5 3.0 2.5 1.5 1.0 ppm •…

A: Note: The product is n-pentyl acetate. Here the alcohol is n-pentanol.