Q: QUESTIONS 1. What are the two main threats to African elephant populations?
A: Disclaimer: - According to Bartleby guidelines, only the 1st question can be answered. Please repost…
Q: How does the human microbiome regulate the environment of mucosal surfaces and protect from…
A: The human microbiome is a collection of microbes that live on or in the human body. These microbes…
Q: Question Antibiotics and antibacterial products have saved a countless number of lives. With all the…
A: Evolution changes the existing traits or gives rise to new traits or species.
Q: 1. During RNA splicing, the of the precursor mRNA are being removed. Exons Introns Promoters…
A: RNA splicing is a process by which non coding sequences of RNA are removed. The coding sequences…
Q: For growth, a mutant bacterium requires that an amino acid not required by the wild parental strain…
A: Answer :- For growth, a mutant bacterium requires that an amino acid not required by the wild…
Q: Explain four clinical symptoms on the human that expose to the etiologic agent in food.
A: Etiological agents are defined as the infectious substances containing microbes or pathogens and can…
Q: 1. One (1) mL of spring water were added to a petri dish to which 30 mL of melted Plate Count Agar…
A: We can look at the issue once we realise that the so-called "plated dilution" actually refers to the…
Q: Illustrate the mechanism of DNA replication in the conservative model.
A: Replication is a process in which the new DNA strand is formed with the help of template parental…
Q: The allele for color-blindness is carried on the X chromosome. Making color blindness (a recessive…
A: The inability to identify certain colour distinctions is known as colour blindness. The retina, the…
Q: What are the two proteins/factors produced by cytotoxic - T cells to kill a virally-infected cell-
A: Introduction : It is type of immune cell which kill certain cells, including foreign cells,…
Q: In a study of coat colour in beach mice, researchers measured the darkness of the fur on the backs…
A: Introduction All of an organism's observable traits, or phenotype, are the outcome of the interplay…
Q: sequence of amino acids.
A: The central dogma of molecular biology is the concept which explains the flow of genetic…
Q: Define about whole-genome sequencing (WGS) ?
A: The study of genomes' design, functioning, development, sequencing, and modification is the emphasis…
Q: Biology Answer the following questions (a)whats is citric acid cycle? why does this occur? where…
A: The hydrotrope and organic substance adenosine triphosphate (ATP) powers a variety of biological…
Q: Contrast ST and NST in humans and non-human animals. Why does Marchand (or any other evidence)…
A: The process through which organisms produce heat is known as thermogenesis. It is found in all…
Q: Define about genomic analysis ?
A: The study of genomes' design, functioning, development, identification, and modification is the…
Q: what is gor
A: GOR method was developed in the late 1970s.
Q: O Males and females are affected equally Question 26 Which of the following is a sex-linked…
A: Introduction Genetic disorders are of two types, sex linked and autosomal. Sex linked disorders are…
Q: Horizontal sequence :VIRL Vertical sequence:MKF Scoring rules: g/o = -3, g/e = -1, match or…
A: A point accepted mutation (PAM) is the replacement of a single amino acid in the primary structure…
Q: Draw the neuromuscular junction and skeletal muscle fiber & provide your reasoning why it's an…
A: Note: As per the guidelines, we are answering the first question here, Please repost the other part…
Q: c. Questions 1. Which wavelengths of light are best absorbed by the chlorophyll extract? 2. Which…
A: Since there are multiple questions in this particular question, I will answer the three subparts for…
Q: 4. Compare the rate of the pepsin-catalyzed reaction at pH = 1.5 with the rate of the lipase-…
A: Enzymes are chemical substances that usually accelerate the rate of a chemical reaction. These…
Q: What are the inheritance patterns and general clinical features of some common genetic disorders?
A: Genetic inheritance is the passing on of traits from parent to offspring. In humans, this process is…
Q: 7. Which of the following codons does NOT represent a stop codon? AUG UAA UAG UGA Biology Knowledge…
A: Stop codon is the sequence of nucleotides in dna or messanger rna. Biome is an area classified…
Q: Evolution Biologists define evolution as the change in the frequency of alleles (variations of a…
A: Introduction: Change in the heritable traits of biological populations over multiple generations is…
Q: which heart valve is circle in the image
A: The primary organ of your circulatory system, a web of blood veins which circulates blood throughout…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…
A: Given DNA strand: 5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'
Q: by means of can reproduce through such as D such as by
A: Sexual reproduction is the type of reproduction in which male and female haploid gametes are fused…
Q: In the given below option which of the following are considered as the main tools for DNA…
A: DNA technology alters the phenotype of the organism through a genetically altered vector. It…
Q: AMPHIBIAN (FROG) 2 5 6
A: Introduction Any member of the vertebrate animal family that can utilize both aquatic and…
Q: Please explain how consumption of different fluids affects the renal system Such as sugary and less…
A: The renal system includes the organs -The kidney, along with the ureters, bladder, and urethra. The…
Q: Which of the following statements is true about linkage disequilibrium? O a. D= -0.21 indicates that…
A: Linkage disequilibrium [D]: This term in population genetics is described as a phenomenon where the…
Q: Restriction sites are palindromic; that is, they read the same inthe 5' to 3' direction on each…
A: Recombinant DNA technology entails changing genetic material outside of an organism to produce…
Q: what is the mechanism by which crocodiles and alligators are able to fiercely resist infections?
A: Immune response is how the body protects itself from substances it perceives as dangerous or…
Q: Why nonhomologous end-joining (NHEJ) is helpful ?
A: Non-homologous end joining (NHEJ) Is a repair process for double-strand DNA breaks. In contrast to…
Q: what is difference among case I, case II, and caseIII?? b) In case I, since % of female are very…
A: The sex determination in reptiles is affected by the temperature which influences the steroids that…
Q: Compare and contrast the process of making "kimchi" and "Greek" yogurt.
A: Yoghurt and kimchi both are prepared by the process of fermentation. Fermentation is a process that…
Q: N mRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Alanine Arginine…
A: Disclaimer: “Since you have posted a question with multiple sub-parts, we will solve first three…
Q: 5. Very happy Escherichia coli cells reproduce on a 20 minute time frame (doubling or generation…
A:
Q: Can you please explain the diagram it has lots of parts and can you explain in simple terms as to…
A: Thyroid hormone is important in the regulation of metabolic rate and also in maintaining lipid…
Q: What are the usual cellular responses to reversible injury?
A: Introduction: Injury frequently connotes physical hurt, but it can also be used more allusively to…
Q: Evolution determines the change in inherited traits over time to ensure survival. There are three…
A: According to this question, they are asking for the population percentage at 0 years. And they have…
Q: Considering the covid-19 pandemic, discuss the importance of adequate water, sanitation and hygiene…
A: Corona virus is responsible for the spread of the pandemic corona 19. It is responsible for the mass…
Q: A botanist two diferen took trans Specimens s microscope Leat from Plant 1 с CC . P The plants а…
A: Stomata are the cell structures which are pore like found in the epidermis of leaves, stems etc.They…
Q: Which of the following is incorrect about the alpha-helix? a. It can be easily identified in the…
A: The alpha helix and beta plated sheath are the secondary structure of proteins. In this case the…
Q: Choose the correct terms to complete this paragraph. The law of conservation of energy states that…
A: Sun is the source of energy that is used by autotrophic organisms such as green plants during…
Q: 12. A. B. C. D. Hemophilia is an x-linked disease in which the blood does not clot normally; it is…
A: Introduction : Haemophilia is an inherited genetic disorder that impairs the body's ability to…
Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…
A: The process of formation of messenger RNA with the help of template strand of DNA is called…
Q: What is the difference between a knockout animal and a transgenicanimal?
A: Knockout and transgenic animals are used in genetic engineering and Biotechnology experiments either…
Q: Molecular marker is used to determine relatedness of species which may directly or indirectly exerts…
A: The core concept of molecular biology is the investigation of three processes: replication,…
Explain about Haemophilus influenzae ?
Step by step
Solved in 2 steps
- Explain how the body (including cells, organs, organ systems) is affected by the bacterium called Neisseria meningitidis? Are there any long-term effects caused by the bacterium, even after recovery?In short Explain why secondary bacterial infection is common in persons with influenza Asap.Explain how primary gout can result from the following enzymes in the image below.