N mRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Alanine Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine Isoleucine Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine mRNA Codons GCU AGA AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG UUU CCU UCU ACU UGG UAU GUA Code-End of the (anticodon) tRNA There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table. 2. What is the one-gene-one-enzyme hypothesis?

N mRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Alanine Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine Isoleucine Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine mRNA Codons GCU AGA AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG UUU CCU UCU ACU UGG UAU GUA Code-End of the (anticodon) tRNA There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table. 2. What is the one-gene-one-enzyme hypothesis?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 18RQ: A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell...

See similar textbooks

Similar questions

Examine Table 15-2. Which amino acids are coded by the following codons? (Hint: For the first base [letter] in each of the codons listed below, look at the leftmost column of the table labeled “First Base.” For the secondbase in each codon, look at the top row of bases, and for the third base, look at the column on the right-hand sideof the page).a. UUUb. UCUc. UAUd. UGCe. CUUf. CGAg. CGGh. AAAi. AAGj. GAGk. GGUl. GGCm. GGAn. GGG
5’-AUGCCGGACUGAAAU-3’ What is the sequence of the resulting protein assuming the ribosome takes the first AUG as triplet codon ?
A scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this itiRNA makes when it is translated?
Energy that drives translation is provided mainly by ___ . a. ATP b. amino acids c. CTP d. all of the above
5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC Find start codon and stop codon UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’
1e) Give the sequence of every codon this tRNA, with the anticodon 5'AGG3', could base pair with (perfect and wobble matches), and name the amino acid coded for by each codon whose sequence you have written.
25. A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? Group of answer choices 1. Asparagine 2. Lysine 3. Threonine 4. Glutamic Acid
5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following amino acid sequence: ILLLSESS Which DNA codon represents I (isoleucine)? a) 5' TCC 3' b) 5' TAG 3' c) 5' ATC 3' d) 5' CCT 3'
From the given DNA base sequence indicated below: 5’’AGCCCATATGGCCCATACGCGGAATCGC 3’ Give the codon sequence and anticodon that will interact from the codon sequence Write the amino acids produced from the codon sequence.
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… c) Give the polypeptide sequence, and identify the N-terminus and C-terminus.
codon: 1 2 3 4 5 6 7 sequence: TAC ATG GAC AAT GAT TAG GGG 1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located . What mutation(s) would eliminate peptide translation? Use the codon numbers to help describe where the mutation is located
1. If an amino acid has a codon that ends in a pyrimidine, which of the following is not necessarily true? (Use genetic code to answer the question) A. The other codon is going to have the same two bases as the first and second as the codon described for this amino acid. B. The same sequence as this codon with a purine as the last base is also a codon for this amino acid. C. It has at least two codons. D. The same sequence as this codon with the other pyrimidine as the last base is also a codon for this amino acid. Please answer asap