Explain don't copy from Google 3. List the three types of fibrous joints.

The Joint is the part of the body where two bones connect together and allow movement. In the human…

Answered: Explain don't copy from Google

Science

Biology

Explain don't copy from Google

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter38: The Musculoskeletal System

Section: Chapter Questions

Problem 18RQ: The elbow is an example of which type of joint? hinge pivot saddle gliding

See similar textbooks

Related questions

Q: what percentage of the total amino acids in the protein would be made up of proline (Pro)?

A: Proline is an amino acid codded by the codons CCG, CCC, CCU, and CCA. Any one of these codons can…

Q: In which type of classification system are names assigned only to groups that include a common…

A: Scientists must assign names to each organism in order to investigate the enormous diversity of life…

Q: What causes diaper dermatitis?

A: The diaper dermatitis is a type of irritated skin on the bottom of the baby or the ones using the…

Q: __________ is a substance secreted by cells in the lungs that reduces surface tension.

A: Introduction : Chemical substances known as surfactants are employed to reduce the surface tension…

Q: Which of the following characteristics is shared by all types of muscle tissue? Question 5…

A: Introduction: Movements in the human body are controlled by muscle cells. Involuntary and voluntary…

Q: CRITICAL THINKING QUESTION – NERVOUS SYSTEM Dan, a 50-year-old man, is experiencing muscle stiffness…

A: In the given scenario, Dan is a 50-year-old person suffering from Parkinson's disease. Parkinson's…

Q: quality control, quality assurance, and quality management)

Q: 2-Female Drosophila heterozygous for three recessive mutations e (ebony body), st (scarlet eyes),…

A: a) When all the progeny are not shown at equality then this indicates that the genes are linked…

Q: Bryophyte Seedless Vascular Plant Angiosperms [Choose ] Mid Largest Smallest [Choose ]

A: Introduction Gametophyte refers to the sexual stage of plants and some algae that involves the…

Q: Julie (a female) has hemophilia. Based on this information, what can we say about the genotypes of…

A: Introduction X-linked diseases are those that occur due to the presence of abnormal/ diseased…

Q: The electron shells in an atom of silicon (atomic symbol Si) each

Q: Given the below data determine the chi square and whether the population is in H-W equilibrium.…

A: Chi-square test allows to measure the difference between observed and expected values. In genetics…

Q: Can you show me the cross and how to get the answers

A: The leaves of the 4-o'clock plant might be green, variegated (white and green), or white. Different…

Q: Which of the following pairs correctly describes an example of antagonistic hormones that regulate…

A: Introduction The institution of glands that secrete chemical currier (hormones) is the endocrine…

Q: The key feature that distinguishes alternation of generations from other life cycles is O a distinct…

A: Introduction Alteration of generation is a life cycle of plants that involves two different phases…

Q: Number of animals (thousands) 140- 120- 100- 80 wwwww 1855 1845 1875 1885 1895 Fig. 4.23 Snowshoe…

A: A predator is an organism that consumes another organism as its food. The organism on which a…

Q: 12.In a zygote that begins with a complement of two homologous chromosomes pairs, A and a, and B and…

A: The number of chromosomes in humans is 46, or 23 pairs. There are two different types of…

Q: Animals in the phylum Mollusca exhibit (choose the correct answer) Question 7 options:…

A: The phylum Mollusca is the second-largest animal phylum. The molluscs include many familiar animals,…

Q: ii) In order to create a western blot, SDS-PAGE is first performed to separate the proteins. After…

A: SDS-PAGE is a protein separation procedure, most widely used in immunoblotting. It can be done once…

Q: Which membrane function makes them able to accommodate the electron transport chain at the inner…

A: Introduction The cell membrane is also called the plasma membrane. It is the biological membrane…

Q: How do the skin blood vessels and sweat glands regulate body temperature?

A: The skin blood vessels regulate body temperature by- During hot climate or when the heat is more…

Q: Here's a line of DNA code: TACACGCCAGAG Transcribe it: (USE caps, no spaces)

A: The process of transcription in which RNA is synthesized from the DNA strand is carried out by the…

Q: Label name only

A: We know that Teeth help us to chew food that would be large enough to swallow. Teeth also help us to…

Q: 1. The antibacterial activity of flavonoids was tested against the bacterial strain, Escherichia…

A: As per our guidelines, we are supposed to answer only three sub-parts. Kindly repost the question…

Q: Which of the following is not a correct description of tissue pathology? Neurilemmoma is a very…

A: Introduction: Diagnosing and characterizing neoplastic and non-neoplastic illnesses of the soft…

Q: blood flow in the left coronary artery is less during systole than diastole

Q: Supposed mitotic and meiotic had never evolve. What do you think would have been the consequences?…

A: Mitosis and meiosis are cell division proces. Mitosis results in cloned cells while meiosis makes…

Q: Planaria are able to regenerate after they are cut in half. Answer the three questions to explain…

A: A planarian can be divided into pieces, and each piece has the ability to grow back into a full…

Q: Sugars starches and cellulose are all types of

A: Macronutrients are nutrients which our body needs in large amounts. These include - carbohydrates,…

Q: Discuss measures you would consider taking to prevent occupational transmission of diseases from…

A: Introduction Diseases that can be spread from one person to another by air or physical contact are…

Q: Alabama's environmental issue

Q: 9. Other than bacteria list the other 6 types of Microorganisms listed in your textbook.asap

A: Microorganisms or microbes are the microscopic organisms that exist as unicellular or multicellular…

Q: What are ribosomes? State the function of ribosomes. In what way eukaryotic ribosomes differ from…

A: A subfield of biology called cell biology examines the composition, operation, and behavior of…

Q: The idea that asexually reproducing populations might acquire and maintain (and not "breed out")…

A: Asexual reproduction is a form of reproduction in which the chromosome count or the fusing of…

Q: The table below shows short DNA sequences from a gene in a closely related group of dragons, as well…

A: We have a group of seven closely related dragon species with homologous gene sequences. These are…

Q: Write the effects of heroin on human body.

A: Introduction :- Heroin is a black, sticky ooze or a white, brown, or brown powder. It is an opioid…

Q: Despite CAM photosynthesis having a comparatively higher water use efficiency relative to C3 and C4…

A: CAM pathway is adapted in plants to perform photosynthesis under stress. The CAM pathway reduces…

Q: Identify a fact about the urinary OR endocrine system (disorder, anatomical structure). Describe…

A: Introduction Glands are a group of cells that produce and secrete enzymes or hormones. Glands are…

Q: M09. Answer correctly. Else

A: We know that Gametogenesis is the process by which gametes are produced. In humans, sperm is the…

Q: Name two bacterial skin infections, and describe the typical lesions.

A: Skin is the largest organ of the human body. It is considered the first line of defense against any…

Q: Describe the incidence and types of child maltreatment or abuse.

A: Maltreatment is the word that tells the quality of care any child receives while the word abuse is…

Q: I need help answer quickly

A: Cells are the basic structural and functional unit of all known organisms which help in the process…

Q: What are the major cells involved in bone resorption?

A: During resorption of bones, some specialized cell break down the bone tissue. This releases calcium…

Q: C- Find the vital capacity for a person with a total lung capacity of 7 L and a residual volume of…

A: Vital capacity can be defined as volume of air exhaled after maximal inhalation. While Total lung…

Q: Which of the following is true about innate immune system? Check all that apply. PAMPs recognize…

A: Introduction Immunity is an ability of an organism to fight against a particular infection. There…

Q: What is mitrochondria?

A: The living, self-reproducing, structural and functional unit of the living organisms is called cell.…

Q: The two major patterns proposed by Darwin are: 1) species change over time, and 2) species give rise…

A: Charles Darwin was a British naturalist who proposed the theory of natural selection in biological…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: What causes the inflammation of acne vulgaris?

A: Acne vulgaris is a skin disorder. It has been seen on the face. Acne vulgaris is a chronic skin…

Q: True or false. The cell walls of plants prevent the process of cytokinesis.

A: Introduction Plant & Animal cell division Plant cell ~ divides by sedimenting a partition…

Question

Explain don't copy from Google

3. List the three types of fibrous joints.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The elbow is an example of which type of joint? hinge pivot saddle gliding
Watch this animation (http://openstaxcollege.org/l/hipreplace) to observe hip replacement surgery (total hip arthroplasty), which can be used to alleviate the pain and loss of joint mobility associated with osteoarthritis of the hip joint. What is the most common cause of hip disability?
Watch this video (http://openstaxcollege.org/l/fractures) to see how fractures of the distal radius bone can affect the wrist joint. Explain the problems that may occur if a fracture of the distal radius involves the joint surface of the radiocarpal joint of the wrist.
Watch this video (http://openstaxcollege.org/l/shoulderjoint1) for a tutorial on the anatomy of the shoulder joint. What movements are available at the shoulder joint?
An example of a wide fibrous joint is ________. the interosseous membrane of the forearm a gomphosis a suture joint a synostosis
Watch this video (http://openstaxcollege.org/l/anklejoint1) for a tutorial on the anatomy of the ankle joint. What are the three ligaments found on the lateral side of the ankle joint?
Define how joints are classified based on function. Describe and give an example for each functional type of joint.
Which of the following is a function of the axial skeleton? allows for movement of the wrist and hand protects nerves and blood vessels at the elbow supports trunk of body allows for movements of the ankle and foot
The forearm consists of the radius and ulna radius and humerus ulna and humerus humerus and carpus
Watch this video (http://openstaxcollege.org/l/hipjoint2) to learn more about the anatomy of the hip joint, including bones, joints, muscles, nerves, and blood vessels. Where is the articular cartilage thickest within the hip joint?
Which of the following is not a characteristic of the synovial fluid? lubrication shock absorption regulation of water balance in the joint protection of articular cartilage
5) List and identify the movements permitted by synovial joints.