Ferritin is treated with SDS or SDS and b-mercaptoethanol and subjected to polyacrylamide gel electrophoresis. Only when very large amounts of bisacrylamide are added do you see two separate bands on the gel at relative migrations of 4.0245 and 3.9375 and the results are the same with and without b-mercaptoethanol. You decide to call these the light and heavy chains of ferritin. What are the actual sizes of the light and heavy chains of ferritin based on the SDS-PAGE data? What types of interactions hold these proteins together in the structure of ferritin?

Ferritin is treated with SDS or SDS and b-mercaptoethanol and subjected to polyacrylamide gel electrophoresis. Only when very large amounts of bisacrylamide are added do you see two separate bands on the gel at relative migrations of 4.0245 and 3.9375 and the results are the same with and without b-mercaptoethanol. You decide to call these the light and heavy chains of ferritin. What are the actual sizes of the light and heavy chains of ferritin based on the SDS-PAGE data? What types of interactions hold these proteins together in the structure of ferritin?

Curren'S Math For Meds: Dosages & Sol

11th Edition

ISBN:9781305143531

Author:CURREN

Publisher:CURREN

Chapter5: Unit, Percentage, Milliequivalent, Ratio, And Household Measures

Section: Chapter Questions

Problem 19SST

See similar textbooks

Similar questions

The estimated size of fusion protein of an antibiotic (540bp) and an anti-inflammatory agent (630 bp). There are an additional 222 bp between the sequences. Assuming the average weight of an amino acid is 114 Da, what is the estimated size of the fusion protein? 53 kDa 44 kDa 59 kDa 159 kDa
Download BLOSUM30 and BLOSUMB0 substitu- tion matrices and place them side by side on your computer screen. What are the differences between the two matrices? Why do you see these differences?
Horizontal sequence :VIRL Vertical sequence:MKF Scoring rules: g/o = -3, g/e = -1, match or mismatch - from PAM250 substitution matrix below. NW algorithm. 1. Complete the scoring matrix. Scoring matrix with PAM250 scores: V I R L M K F 2. Set up, initialize and complete the NW matrix. 3. Retrace, align and score alignment(s). Use the arrows and circles for the matrix and path(s). V I R L M K F Align and score all optimal alignments here. PLZ the arrows and circles for the matrix and path(s) AND SHOW ALL possible Alignment
In not more than 200 words, explain how the human genome of 3.4 Gb would be in 2.3 meters long when stretched linearly if this size is fit into a cell of minuscule proportions.
Shown below are two homologous lengths of the alpha and betachains of human hemoglobin. Consult a genetic code dictionary and determine how many amino acid substitutionsmay have occurred as a result of a single nucleotidesubstitution. For any that cannot occur as a result of a singlechange, determine the minimal mutational distance. Alpha: ala val ala his val asp asp met proBeta: gly leu ala his leu asp asn leu lys
In kilodaltons (KDa), what is the predicted molecular mass of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? Answer in numerical digits only
Horizontal sequence :VIRL Vertical sequence:MKF Scoring rules: g/o = -3, g/e = -1, match or mismatch - from PAM250 substitution matrix below. SW algorithm. 1. Complete the scoring matrix. Scoring matrix with PAM250 scores: V I R L M K F 2. Set up, initialize and complete the SW matrix. 3. Retrace, align and score alignment(s). Use the arrows and circles for the matrix and path(s). V I R L M K F Align and score all optimal alignments here.
which substitution matrix would you choose for a BLASTP search? justify your choice.
Comment on the alignment? What is the root mean square (RMS)? Can you think of any potential issues?
Sequence wise otherwise vote.
You have purified a recombinant form of the p53 protein from E. coli and determined the A280 to be1.35. Calculate the molar and mass concentration of the purified protein if the extinction coefficientand molecular weight of p53 is 35,410 M-1 cm-1 and 43,653 Da, respectively (l = 1 cm).
For the following sequence, what is the approximate annealing temperature? 5'-AGCTACGATCAGGTCA-3'