Fill in the blanks and explain the relationship between the paired words/phrases a. dietary DNA: _______; dietary carbohydrates: monosaccharides b. ATP: source of energy; ________: secondary messenger/regulatory molecule c. ________: de novo pyrimidine biosynthesis; cytosine: salvage pathway of pyrimidine biosynthesis

Fill in the blanks and explain the relationship between the paired words/phrases a. dietary DNA: _; dietary carbohydrates: monosaccharides b. ATP: source of energy; : secondary messenger/regulatory molecule c. __: de novo pyrimidine biosynthesis; cytosine: salvage pathway of pyrimidine biosynthesis

Ebk:Nutrition & Diet Therapy

10th Edition

ISBN:9780357391747

Author:DEBRUYNE

Publisher:DEBRUYNE

Chapter8: The Vitamins

Section: Chapter Questions

Problem 6SC

See similar textbooks

Similar questions

In the digestion of Carbohydrates, the more complex carbohydrate molecules are broken down into smaller molecules such as the Monosaccharides. This breakdown of complex carbohydrate into simple sugars is an example of: a. Catabollism b. Anabolism
Catalase, sucrase, lactase are examples of... A. simple sugars B. nitrogen bases C. enzymes D. lipids
B complex vitamins major function is to_____ Group of answer choices All of the above Act as Co-Enzymes Participate in production of ATP Transform energy
Beta oxidation is ______. a. the breakdown of sugars b. the assembly of sugars c. the breakdown of fatty acids d. the removal of amino groups from amino acids
A ribozyme consists of ___________. a. clay c. DNA b. lipids d. RNA
Protease acts on proteins to convert them into amino acids. Which of the following statements is correct? a. Protease is produced in the salivary glands. b. All of the answers. c. The enzyme is protease and amino acids are the products. d. Amino acid is the substrate which acts on the enzyme. e. Protease is the substrate while amino acids are the products.
Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ 5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’ Which strand is the template strand?
If people have lactose intolerance they cannot break down lactose, therefore what would lactaid contain to help them? Select one: a. cellulase coenzymes b.actase coenzymes c.cellulase enzymes d.protease enzymes e.lactase enzymes
_____________ occurs within mitochondria. a. fatty acid synthesis b. β-oxidation c. VLDL synthesis d. LDL oxidation
Among the given statements, which ones are correct about the biological functions and commercial uses of carbohydrates? A. Glucose serves as the substrate for photosynthesis in plants. B. Glycogen serves as a repository of glucose in the myocytes. C. The cell wall of plants is reinforced by a polymer of beta-D-glucose. D. Lactose is widely used as filler in tablets and capsules in the pharmaceutical industry. E. Corn extract is commercially hydrolyzed to yield fructose-rich sweeteners.
Which of the following are differences between starch and glycogen? A. Starch is a mixture of amylose and amylopectin while glycogen is a pure biopolymer. B. The amylopectin instarch has more branches than glycogen. C. Starch is the storage form of glucose in plants while glycogen is in animals and humans. D. The branches in amylopectin is alpha 1->6 while itis beta 1-->6 in glycogen. E. Starch reacts more intensely with Lugol's reagent than glycogen.
Which of the following is true about the phosphorylation of proteins? A. Proteins are usually phosphorylated at amino acids that have hydroxyl group-containing side chains. B. Phosphorylation of proteins is catalyzed by phosphatases. C. Phosphoryation always activates enzymes. D. The specificity in phosphorylation is conferred solely by the amino acid to be phosphorylated.