FirstSecond LetterThirdLetterAGLetterphenylalaninephenylalanineserinetyrosinecysteineserinetyrosinecysteineleucineserinestopstopAleucineserinestoptryptophanGleucineprolinehistidinearginineUhistidinearginineargininearginineleucineCprolineprolineleucineglutamineAleucineprolineglutamineGisoleucinethreonineasparagineserineisoleucinethreonineasparagineserineAisoleucinethreoninelysineargininearginineglycineglycineglycineAmethioninethreoninelysineGvalinealanineaspartatevalinealanineaspartateCGvalinealanineglutamateAvalinealanineglutamateglycineGIf the sequence of DNA on the template strand of a gene is AAA, the MRNAcodon produced by transcription will beand will specify the amino acid

Gene is present in the DNA. It is made up of sequence of nucleotides. It encodes a protein.

First Second Letter Third Letter U A G Letter phenylalanine phenylalanine serine tyrosine cysteine U serine tyrosine cysteine C leucine serine stop stop A leucine serine stop tryptophan G leucine proline histidine arginine U arginine arginine arginine leucine C proline proline histidine leucine glutamine A leucine proline glutamine G isoleucine threonine asparagine serine U isoleucine threonine asparagine lysine serine C A isoleucine threonine arginine arginine glycine glycine A methionine threonine lysine G valine alanine aspartate valine alanine aspartate C G alanine glycine glycine valine glutamate valine alanine glutamate G If the sequence of DNA on the template strand of a gene is AAA, the MRNA codon produced by transcription will be and will specify the amino acid

First Second Letter Third Letter U A G Letter phenylalanine phenylalanine serine tyrosine cysteine U serine tyrosine cysteine C leucine serine stop stop A leucine serine stop tryptophan G leucine proline histidine arginine U arginine arginine arginine leucine C proline proline histidine leucine glutamine A leucine proline glutamine G isoleucine threonine asparagine serine U isoleucine threonine asparagine lysine serine C A isoleucine threonine arginine arginine glycine glycine A methionine threonine lysine G valine alanine aspartate valine alanine aspartate C G alanine glycine glycine valine glutamate valine alanine glutamate G If the sequence of DNA on the template strand of a gene is AAA, the MRNA codon produced by transcription will be and will specify the amino acid

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Synthesize a Protein Below is a region of a gene. Transcribe the gene into a pre-mRNA strand. DNA C T A T T G C A C C T G A G T C C A mRNA What is the name of the enzyme which catalyzes this reaction? _________________________________ What three things must then happen to the pre-mRNA you just synthesized before it is allowed to exit the nucleus?
5’ UGG CAA UCC UAC GAU 3’ Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the mRNA. 2. Write out a possible miRNA that could regulate the expression of this gene
mRNA: 5’ – UGAUCAUGAUCUCGUAAGAUAUC – 3’ -Draw a box around the sequence where protein synthesis will begin. What is this sequence called? Does an amino acid get inserted at this site? If so, which one? -Draw in an arrow to show the direction that a ribosome will move along the mRNA strand. -From the starting point, mark off the codons, and identify the correct amino acid that will be inserted at that codon. -Draw a second box around the sequence where protein synthesis will stop. What is this sequence called? -Label the N-terminus and C-terminus of the polypeptide (amino acid) chain.
Give typing answer with explanation and conclusion to all parts Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the template sequence this mRNA was transcribed from? Include 5’ and 3’ labels. b) Based on this sequence, what you predict would be the resulting peptide sequence from it. c) In examining this sequence what is the proper reading frame of the open reading frame? (+1, +2, +3, -1, -2, or -3). d) What would you predict the peptide sequence to be if there was the following mutation that led to a base change: 5’-ACTGATGCATGCCAGGGGTTTTCAACTAAAATGAAA-3’
A scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this itiRNA makes when it is translated?
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
Discuss Concepts The normal form of a gene contains the nucleotide sequence: When this gene is transcribed, the result is the following mRNA molecule: In a mutated form of the gene, two extra base pairs (underlined) are inserted: What effect will this particular mutation have on the structure of the protein encoded in the gene?
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
A binding .site for RNA polymerase is called a ___ . a. gene b. promoter c. codon d. protein
A scientist observes that a cell has an RNA polymerase deficiency that prevents if from making proteins. Describe three additional observations that would together support the conclusion that a defect in RNA polymerase I activity, and not problems with the other polymerases, causes the defect.
A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.
0. Explain how differences in the initiation of translationdictate that eukaryotic mRNAs are monocistronicwhile prokaryotic mRNAs may be polycistronic.