mRNA: 5’ – UGAUCAUGAUCUCGUAAGAUAUC – 3’ -Draw a box around the sequence where protein synthesis will begin. What is this sequence called? Does an amino acid get inserted at this site? If so, which one? -Draw in an arrow to show the direction that a ribosome will move along the mRNA strand. -From the starting point, mark off the codons, and identify the correct amino acid that will be inserted at that codon. -Draw a second box around the sequence where protein synthesis will stop. What is this sequence called? -Label the N-terminus and C-terminus of the polypeptide (amino acid) chain
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
mRNA: 5’ – UGAUCAUGAUCUCGUAAGAUAUC – 3’
-Draw a box around the sequence where protein synthesis will begin. What is this sequence called? Does an amino acid get inserted at this site? If so, which one?
-Draw in an arrow to show the direction that a ribosome will move along the mRNA strand.
-From the starting point, mark off the codons, and identify the correct amino acid that will be inserted at that codon.
-Draw a second box around the sequence where protein synthesis will stop. What is this sequence called?
-Label the N-terminus and C-terminus of the polypeptide (amino acid) chain.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
