Font Paragraph Styles Editing Voice Editor Reuse Files ...1. .. 2. . . 3 -. . .. 4- . ... 5-... 6.. 7... . 8... . . . .. As you now know, a gene is a sequence of nucleotides in a DNA molecule that directs the formation of a protein. In the activity below, you will find the gene that codes for the protein known as beef Insulin, which is a protein that breaks down sugar in a cow's blood. Begin by transcribing the gene into MRNA. Then use the MRNA sequence and the codon table to translate the gene into a protein. Use the three letter abbreviations contained in the table to fill in the beef insulin molecule. ТАССAGTTAGTтсGTAGACACCсТСAGTGGATCАССТСCGGGATАТАААССАААСGсCСCT AUGGUCAAUCAGCAUCUGUGGGAGUCACCUAGUGGAGGCCCUAUAUUUGGUUUGCGGCGA CTCTCCCAAGAAAATGATGGGGTTTCGTCCATAACACCTTGTCACAACAGCAAGACAAAC GAGAGGGUUCUUUUACUACCCCAAAGCAGGUAUUGUGGAACAGUGUUGUCGUUCUGUUUG АAGCAACATGGTTAACCTCTTААТААСGATCTАА UUCGUUGUACCAAUUGGAGAAUUAUUGCUAGAUUAA

Font Paragraph Styles Editing Voice Editor Reuse Files ...1. .. 2. . . 3 -. . .. 4- . ... 5-... 6.. 7... . 8... . . . .. As you now know, a gene is a sequence of nucleotides in a DNA molecule that directs the formation of a protein. In the activity below, you will find the gene that codes for the protein known as beef Insulin, which is a protein that breaks down sugar in a cow's blood. Begin by transcribing the gene into MRNA. Then use the MRNA sequence and the codon table to translate the gene into a protein. Use the three letter abbreviations contained in the table to fill in the beef insulin molecule. ТАССAGTTAGTтсGTAGACACCсТСAGTGGATCАССТСCGGGATАТАААССАААСGсCСCT AUGGUCAAUCAGCAUCUGUGGGAGUCACCUAGUGGAGGCCCUAUAUUUGGUUUGCGGCGA CTCTCCCAAGAAAATGATGGGGTTTCGTCCATAACACCTTGTCACAACAGCAAGACAAAC GAGAGGGUUCUUUUACUACCCCAAAGCAGGUAUUGUGGAACAGUGUUGUCGUUCUGUUUG АAGCAACATGGTTAACCTCTTААТААСGATCTАА UUCGUUGUACCAAUUGGAGAAUUAUUGCUAGAUUAA

Name: How is transcription and translation simulated in this activity? AutoS
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: How is transcription and translation simulated in this activity? AutoSave ● ffBUILD A PROTEIN LAB ACTIVITY • Saved to this PC -O Search (Alt+Q)A Tanya Abigail ClemenTAFileHomeInsertDrawDesignLayoutReferencesMailingsReviewViewHelpO Comments vA ShareX

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 17P: Exploring the Structure of the 30S Ribosomal Subunit Go to www.pdh.org and bring up PDB file 1GIX,...

See similar textbooks

Similar questions

The precise biochemical activity of a protein is described ina) Phenotypic functionb) Cellular functionc) Molecular functiond) Structural genomics
Please ASAP. Thank you. How does the mutation change/affect the structure of the Hb heterotetramer (ie how is quaternary protein structure affected)?
DO NOT COPY OLDER ANSWERS! AND SHOW FULL WORK! I have a mixture of 4 proteins, whose sequences are shown below (note that each protein is a 100-repeat of the sequence shown). Protein A: (Gly-Ala-Lys-Val-Ile-Phe-Glu-Val-Asn-Gly) Protein B: (Ala-Ala-Lys-Arg-Ile-His-Glu-Ala-Asn-Lys) Protein C: (Glu-Val-His-Asp-Ala-Asp-Glu-Val-Asn-Asp) Protein D: (Ala-Lys-Arg-Phe-Trp-Phe-Gly-Ile-Ala-Gly) 1) Which protein/s are MOST LIKELY to precipitate out at a pH of 3.5? a) A b) B c) C d) D e) B & C f) A & D g) None of them h) Cannot be determined.
GTTTTCACTGGCGAGCGTCATCTTCCTACT 10. Generate a secondary structure prediction for one identified protein.
pls help ASAP, thank you! “which feature of protein folding is NOT accurate?”
Define the following terms:a. protein motifb. conjugated proteinc. dyneind. zwitterione. electrophoresis
Experiment: Bradford protein assaygive the answers (4-5 lines) of review questions in the end. answer should be logical and understandable and without plagiarism. avoid copy pasting. Background information:The Bradford assay is very fast and uses about the same amount of protein as the Lowry assay. It is fairly accurate and samples that are out of range can be retested within minutes. The Bradford is recommended for general use, especially for determining protein content of cell fractions and assessing protein concentrations for gel electrophoresis. The method described below is for a 100 µl sample volume using 5 ml color reagent. It is sensitive to about 5 to 200 micrograms protein, depending on the dye quality. In assays using 5 ml color reagent prepared in lab, the sensitive range is closer to 5 to 100 µg protein. Scale down the volume for the "micro assay procedure," which uses 1 ml cuvettes. Protocols, including use of microliter plates are described in the flyer that comes with…
Exploring the Structure of the 30S Ribosomal Subunit Go to www.pdh.org and bring up PDB file 1GIX, which shows the 30S ribosomal subunit, the three tRNAs, and mRNA. In the box on the right titled â€˜Biological Assembly.â€� click â€œMore Images.â€� and then scroll down to look at the Interactive Vic By moving your cursor over the image, you can rotate it to view it from any perspective. a. How are the ribosomal proteins represented in the image? b. How is the 16S rRNA portrayed? c. Rotate the image to see how the tRNAs stick out from the structure. Which end of the tRNA is sticking out? d. Where will these ends of the tRNAs lie when the 50S subunit binds to this complex?
Please ASAP. Thank you. Regarding the double helix of DNA, which of the following is true? a. Guanine pairs up with cytosine with three hydrogen bonds b. Complementary strands of DNA are held together by covalent bonds c. The backbone consists of ribose sugars H-bonded to phosphate groups d. Uracil pairs up with adenine with two hydrogen bonds
firt imagine right side An SDS-PAGE electrophoresis obtained after protein extraction is shown in Figure 1. Protein kaleidoscope standards and precision were present in Well 1 (far right). Laemmle + DTT was in well number two. Precision plus protein unstained standards, which aid in the identification of protein sizes, were present in Well 3. Catfish protein extract was present in well 4. Cod protein extract from cod was found in well 5. Flounder protein extract was found in well 6. Trout Protein extract from swordfish was found in well 7. Tuna protein extract was present in well 8. Standards for Actin and Myosin were found in Well 9. Lastly, Laemmle was found in well 9. As shown on the left, the protein sizes varied from 10 kD to 250 kD. analyze please ? second imagine rigth side please Figure 2 depicts a membrane after western blotting. Well 1, located on the far left, featured precise and protein-rich kaleidoscopic standards that aided in the identification of protein sizes. The…
3. In studying normal and mutant forms of a particularhuman enzyme, a geneticist came across a particularly interesting mutant form of the enzyme. Thenormal enzyme is 227 amino acids long, but themutant form was 312 amino acids long. The extra85 amino acids occurred as a block in the middleof the normal sequence. The inserted amino acidsdo not correspond in any way to the normal proteinsequence. What are possible explanations forthis phenomenon? How would you distinguishamong them?
Lab was on the translation process from mRNA to amino acid, post-translational modification of proteins, protein synthesis processing in the ribosome, the primary, secondary, tertiary and quaternary structures of protein and the basic principles of mass spectrometry (MALDI-TOF) Reflect on three to four key concepts that you learned in this lab exercise. How could the lessons learned in this virtual lab relate to a real world situation in the community/world or your future career? Be specific in your answer (this should require 5-10 sentences)