For each of the proteins involved in DNA replication in E.coli that is shown, select the best description.
Q: In a DNA Double helix ,why doesn't an A or T form two hydrogen bonds(out of the three possible) with…
A: DNA is a double helix structure that consists of four nitrogenous bases names Adenine (A), Thymidine…
Q: For the top three nucleotides, number all the carbons in the sugars, circle the nitrogenous bases,…
A: A polynucleotide is a molecule made up of nucleotide monomers that are joined together by covalent…
Q: le) Frrors may occur during DNA replication, resulting in a change to the sequence of base triplets.…
A: Through the replication process, the information from one DNA molecule is replicated to create two…
Q: Is there any situation in which DNA is made based on a RNA template? What is the enzyme involved?
A: ANSWER;- The cycle in which DNA is synthesized having as a layout an RNA chain is called reverse…
Q: a bacterial genome consists of 13% guanosine nucleotides, what fraction of the genome is made of…
A: The question is about the nitrogenous bases that is adenine, cytosine,guanine and thymine ( in RNA…
Q: What protein is key in the termination process of DNA replication in E. Coli?
A: In molecular biology, DNA replication is the biological process of producing two identical DNA…
Q: When proteins recognize and bind to a specific sequence in DNA, why do they usually just recognize…
A: DNA binding proteins are proteins that bind to single or double stranded DNA generally in the major…
Q: Why are there nucleotides (A, T, G, and C) in the master mix? What are the other components of the…
A: PCR is a technique that results in exponential amplification of a selected region of a DNA molecule…
Q: List three important structural motifs in DNA-binding proteins
A: Transcription is the process in which the production of mRNA from one of the strands of DNA, with…
Q: in the DNA of certain bacterial cells, 13% of the nucleotides are adenine. What are the percentages…
A: Deoxyribonucleic Acid (DNA) is a double-stranded, right-handed helical molecule that is twisted…
Q: DNA repair enzymes that correct deamination and depurination must preferentially recognize these…
A: DNA damage occurs when negative changes occurs in DNA due to endogenous or exogenous factors, The…
Q: If a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence…
A: Introduction Genome consists of DNA/RNA which consists of nucleotides either deoxyribose…
Q: Give the ABBREVIATED NAME of the nucleotide in the 5' end." OCH
A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Why are the activated nucleotides in nucleic acid polymerization reactions 5’-triphosphates?
A: According to the question, we have to explain the reason for the activated nucleotides in nucleic…
Q: Within the template strand of the DNA in a gene, the sequence TAT is changed by mutation to TAC.…
A: Gene expression refers to the complex, highly-regulated biological process, which involves the…
Q: Define cytotoxic nucleotide.
A: Introduction DNA strand is composed of three components: Deoxyribose Sugar Nitrogenous Bases…
Q: If the anticodon of a molecule of tRNA has the sequence GAU, what was the original DNA sequence?
A: Question - If the anticodon of a molecule of tRNA has the sequence GAU, what was the original DNA…
Q: Two highly negatively charged complementary strands of DNA come together to form a double helix.…
A: Deoxyribonucleic acid (DNA) is the nucleic acid which contains the hereditary information that is…
Q: What entropic factor destabilizes helical DNA at high temperature?
A: The double (ds) stranded DNA undergoes structural changes also known as denaturation at high…
Q: For a protein-DNA binding reaction with ΔH = 0, sketch the van’t Hoff plot, label both axes.
A: Van't hoff equation gives the relationship between equilibrium constant, temperature, and enthalpy…
Q: Regarding the diagram below, this enzyme is responsible for creating an exact replica of DNA in one…
A: DNA replication is the process of replication of the DNA material in a semi-conservative manner.…
Q: Which of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA…
A: Ans - a.) 5’- G A G C G A T C G C T C - 3’ 3'- C T C G C T A G C G A G -5'…
Q: Draw the syn conformation of purine residues in Z-DNA.
A:
Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…
A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…
Q: Give the sequence of unpaired bases that would be sticky with the following sequences:(a) GGTAC (b)…
A: Restriction endonucleases may cut DNA. The ends of the DNA may be blunt or sticky. A straight cut…
Q: If a bacterial (E. coli) cell has 50,000 bp, how long will be a normal DNA replication?
A: Different macromolecules are present in the body, and they include carbohydrates, proteins, lipids,…
Q: Given the structures of the nitrogenous bases shown in the picture, draw the structure of a part of…
A: The nitrogenous bases shown in the figure are Adenine (A), Guanine (G), cytosine (C), uracil (U) and…
Q: identify the type of DNA binding motif is shown and the characteristics.
A: DNA stands for deoxyribonucleic acid. A DNA-binding domain consists of a structural motif that…
Q: In NOT more than 200 words, explain how the double-helical structure of DNA suggests a mechanism for…
A: DNA replication: It is a process of producing two identical replicas of DNA for one original DNA.
Q: Which type of information about the nucleotide sequenceof the target DNA is required ?
A: Targeted sequencing is defined as a process in which there is a rapid as well as…
Q: Insulin is synthesized as preproinsulin, which has 81 amino acids. How many heterocyclic bases must…
A: Insulin is synthesized from preproinsulin. The preprotein is then cleaved by a proteolytic enzyme to…
Q: How many RNA bases are Explain your answer. required to code for a protein that contains 250 amino…
A: Transcription is the process in which one stranded mRNA is synthesized from two stranded DNA…
Q: Which statement is TRUE regarding the DNA ligase mechanism?
A: DNA ligases DNA ligases are the enzymes that are responsible for joining the two strands of DNA by…
Q: Draw deoxyribonucleosides in the conformation they would appear in Z-DNA and B-DNA.
A: Z DNA
Q: calculate the minimum # of nucleotide base pairs needed to code for B-globin
A: Hameoglobin is the protein that is present in the blood ,it carries oxygen and help in its transport…
Q: In a single strand of DNA, is it ever possible for the number of adenines to be greater than the…
A: In a DNA molecule purine always pairs with a pyrimidine base. Adenine is a purine base and thymine…
Q: If the nucleotide at position 23 in thw first strand of DNA ia changed to "A", what effect would…
A: The change in the nucleotide sequence can occur due to the mutation in the gene expression. These…
Q: In a DNA oligonucleotide, two nucleosides are linked together with a:
A: RNA (ribose nucleic acid) is more sensitive to alkaline hydrolysis because it has a hydroxyl group…
Q: A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a…
A: Melting temperature is the point at which 50% of double-helical DNA is changed into a…
Q: Considering prokaryotes, what is the term for the triplet of nucleotides that codes for an amino…
A: Asked : Term for the triplet of nucleotides that codes for an amino acid
Q: Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents…
A: Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) Sense strand is also known as…
Q: E. coli has two tRNAs for methionine. What is the basis for the distinction between the two?
A: Protein is one of the macromolecules found in the body. Proteins are synthesized using the…
Q: Amino acids have an average molar mass of 100 g/mol.How many bases on a single strand of DNA are…
A: Given: molar mass = 5.0×105 g/mol = 500000 g/mol average molecular weight of an amino acid = 100…
Q: Type the matching bases in each DNA sequence. G A T A G C T A G G
A:
Q: You add 1 ul of EcoRI into 50 ul of your reaction of which contains 10 ug of DNA. How long would it…
A: 1 hr
Q: With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the…
A: The process by which DNA gets converted into RNA molecule is called as transcription and then mRNA…
Q: Explain, on the basis of nucleotide structure, why DNA synthesis proceeds in the 5’-to-3' direction.
A: The deoxyribonucleic acid (DNA) is known as a double helix structure in which two strands are joined…
Q: E. coli oriC is rich in A · T base pairs. Why is this advantageous?
A: E.coli is a gram-negative bacteria that is found in the lower part of the intestine if warm blood…
help please
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- During high stress environments, it has been found that some bacteria activate a genetic mechanism that allows them to incorporate more mutations into the DNA during replication. Would the following two enzymes be impacted by such a mechanism? (i)DNA polymerase IIIii) HelicaseExtreme UV exposure leads to the SOS response in bacteria. By what mechanism does the SOS response function? Answer choices induction of photolyase and the addition of white light to remove the thymine dimer destruction of lexA, which leads to expression of an alternate, error-prone DNA polymerase homologous recombination repair non-homologous end joining exinuclease removal of a segment of DNA including a thymine dimer, followed by the replacement of DNA using the complementary strand of DNAWhich of the following statements is FALSE regarding the molecular mechanism for DNA polymerases? A. The active site contains 2 divalent metal ions B. A single stranded DNA template is required C. The enzyme can only attach a new deoxynucleotide to the 5’ end of a growing chain D. The 3’OH on the deoyxyribose ring attacks a phosphate of a dNTP to produce a new phosophodiester bond E. None of the above (all are true statements)
- All are correct about DNA gyrase in E. coli EXCEPT: It works to remove positive supercoiling introduced by the DnaB protein (helicase). It is a topoisomerase that hydrolyzes ATP during its reaction mechanism. Its mechanism involves the breaking of a single phosphoester bond in one strand of dsDNA. It works to relieve supercoiling in DNA to overcome the torsion stress imposed upon unwinding.Wild-type E. coli takes up and concentrates a certain redfood dye, making the colonies blood red. Transposonmutagenesis was used, and the cells were plated on fooddye. Most colonies were red, but some colonies did nottake up dye and appeared white. In one white colony, theDNA surrounding the transposon insert was sequenced,with the use of a DNA replication primer identical withpart of the end of the transposon sequence, and the sequence adjacent to the transposon was found to correspond to a gene of unknown function called atoE, spanning positions 2.322 through 2.324 Mb on the map(numbered from an arbitrary position zero). Propose afunction for atoE. What biological process could be investigated in this way, and what other types of white colonies might be expected?Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5' A) What would be the protein associated with this DNA template strand? Give the sequence of amino acids encoded by this fragment. Leave traces of your steps. B) In the synthesis of this protein, what are the codon and the anticodon for? Explain in one sentence for each. C) We find, in another cell, a mutation of this DNA template strand: 3' ATA GCG TGG AGT ATC-5’ 1. What type of point mutation is it? 2. Did this mutation arise during transcription, translation or DNA replication? D) If this mutation is found in a spermatozoon, will it have an effect on the individual, its offspring or both? Briefly explain
- PolyADP-ribose polymerase (PARP) plays a keyrole in the repair of DNA single-strand breaks. In the pres-ence of the PARP inhibitor olaparib, single-strand breaksaccumulate. When a replication fork encounters a sin-gle-strand break, it converts it to a double-strand break,which in normal cells is then repaired by homologousrecombination. In cells defective for homologous recom-bination, however, inhibition of PARP triggers cell death.Patients who have only one functional copy of theBrca1 gene, which is required for homologous recombina-tion, are at much higher risk for cancer of the breast andovary. Cancers that arise in these tissues in these patientscan be treated successfully with olaparib. Explain how it isthat treatment with olaparib kills the cancer cells in thesepatients, but does not harm their normal cells.The anti-viral drug Acyclovir is a nucleotide analog that is lacking the 3’ OH group which is required to form a 3’→5’ phosphodiester bond. This drug is ineffective against DNA polymerases with proofreading abilities, which is why human DNA polymerases are not targeted. Acyclovir can be used to treatsevere cases of Epstein-Barr viral (EBV) infection, but has little to no effect under non-severe infections. Based on this information, EBV will use ________ DNA polymerase during severe infections and __________ DNA polymerase during non-severe infections. Human; Human EBV; Human EBV; EBV Human; EBVBelow is a diagram of DNA replication as currently believed to occur in E. coli. From specific points, arrows are provided that lead to numbers. Answer the questions below relating to the locations specified by the numbers. (02) What end (5’ or 3’) of the molecule is here? (State which) What enzyme is probably functioning here to deal with supercoils in the DNA? What enzyme is probably functioning here to unwind the DNA? What nucleic acid is probably depicted here? What are these short DNA fragments usually called? What enzyme probably functions here to couple these two newly synthesized fragments of DNA? Is this strand the leading or lagging strand? What end (5’ or 3’) of the molecule is here? (State which)
- Ultraviolet light can cause covalent linkages between consecutive pyrimidine bases in DNA (up to 100 per second in a single cell in sunlight!). These bulky lesions (i.e. cyclobutane pyrimidine dimers and 6-4 photoproducts), which inhibit DNA and RNA polymerases, are mostly reversed by CPD photolyase when light >300 nm is available to power the reaction. In the dark, however, which DNA repair system is best able to correct these errors? a) non-homologous end-joining b) mismatch repairc) nucleotide-excision repaird) base-excision repair e) homology-directed repairDNA polymerase occasionally incorporates the wrong nucleotide during DNA replication. If left unrepaired, the base-pair mismatch that results will lead to mutation in the next replication. As part of a template strand, the incorporated wrong base will direct the incorporation of a base complementary to itself, so the bases on both strands of the DNA at that position will now be different from what they were before the mismatch event. The MER-minus strain of yeast does not have a functional mismatch excision repair system, but it has normal base excision repair and nucleotide excision repair systems. Which of the following statements is correct about differences in the mutation spectrum between MER-minus and wildtype yeast? More than one answer is correct. Options: More point mutations will arise in MER-minus yeast. Fewer point mutations will arise in MER-minus yeast as compared with wildtype. Of the total point mutations that…Shown below is a long template strand of DNA where lagging strand DNA synthesis is occurring. The short horizontal lines represent two Okazaki fragments that have already been made. In the context of the replication fork, select the letter(d–g) that indicates where primase will synthesize the next RNA primer. Explain why did you choose that location?