Which of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA binding protein? (Note that only one strand of the DNA is shown - you will find it helpful to write down the sequence and the sequence of the opposite strand to answer this question.) a) 5’- G A G C G A T C G C T C - 3’ b) 5’- G A G C G A G A G C G A - 3’ c) 5’- G A G C G A A G C G A G - 3’
Q: G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g…
A: Dna is read in 5 ' to 3 ' direction and the mrna is read by the trna in the form of genetic code by…
Q: Bearing in mind the different number of hydrogen bonds that form between the two different purine-…
A: DNA and RNA are polynucleotides that are composed of a chain of nucleotide monomers with distinct…
Q: Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: The template strand of a double helical segment of DNA consists of the following sequence:…
A: INTRODUCTION: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…
Q: When proteins recognize and bind to a specific sequence in DNA, why do they usually just recognize…
A: DNA binding proteins are proteins that bind to single or double stranded DNA generally in the major…
Q: If the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became…
A: A point mutation or substitution is a form of genetic mutation where a 1 single nucleotide base is…
Q: At a specific area of a chromosome, the sequence of nucleotides below is present where the chain…
A: Replication is the process of making of daughter DNA from the parental DNA.
Q: The compound known as nitrous acid is a reactive chemical that replaces amino groups (−− NH2) with…
A: The given compound nitrous acid substitutes the cytosine(C) with uracil (U) and adenine (A) with…
Q: What would be a primer sequence synthesized from the following DNA sequence: 5'-ACGTG-3'? out of…
A: DNA polymerase cannot start DNA replication on its own. They require short double stranded region to…
Q: in the DNA of certain bacterial cells, 13% of the nucleotides are adenine. What are the percentages…
A: Deoxyribonucleic Acid (DNA) is a double-stranded, right-handed helical molecule that is twisted…
Q: f a DNA-binding protein “reads” a short stretch of DNA and detects the following “second” genetic…
A: In DNA, there are four nitrogenous bases namely, Adenine (A), Guanine (G), Thymine (T) and Cytosine…
Q: In a DNA double helix, why doesn't an A or T form two hydrogen bonds (out of the three possible )…
A: The DNA (deoxyribonucleic acid) is composed of nucleotides that are in turn made up of nitrogenous…
Q: What part(s) of a nucleotide (namely, phosphate, sugar, and/or base) is/are found in the major and…
A: DNA is a molecule that is in charge of bearing and transmitting inherited information or genetic…
Q: Where would you expect DNA-binding proteins to bind if they recognize a specific base sequence? What…
A: Deoxyribonucleic acid (DNA) is a hereditary molecule that transfers genetic information from one…
Q: If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following…
A: DNA universally has 4 N-bases: Adenine, Thymine, Guanine and Cytosine If the given strand sequence…
Q: Which of the following features is associated with the Watson and Crick model of the DNA? A a purine…
A: DNA stands for deoxyribonucleic acid and it has a double-helical structure. The backbone of the DNA…
Q: All of the following statements are correct EXCEPT a. DNA forms described by Watson and Crick have…
A: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that coil around each…
Q: A closed circular duplex DNA has a 100-bp segment of alternating C and G residues. On transfer to a…
A: B-DNA IS BIOLOGICALLY THE MOST COMMON –RIGHT-HANDED (20 ANGSTROM (A) DIAMETER) –COMPLEMENTARY…
Q: If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following…
A: The nitrogenous bases of two polynucleotides in a DNA molecule are linked through hydrogen bonds…
Q: Are the following base sequences “sticky” (complementary) or not? All sequences are written 5′ to…
A: The purines (adenine and guanine) and the pyrimidine (cytosine, thymine) are the two types of…
Q: You prepare a reaction mix containing (i) DNA polymerase II, (ii) DATP, dCTP, DGTP, Mg2+, and…
A: DNA replication is considered a process, during which new strands are synthesized.
Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written…
A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…
Q: Why is it unfavorable for RNA molecules to adopt a double-helix structure similar to B-DNA?
A: Introduction : Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are probably the most…
Q: Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure?…
A: Double-stranded DNA consists of two polynucleotide chains each strand having a phosphodiester…
Q: Each of the following sequences has a total of 20 nucleotides (note that the first six are the same…
A: Introduction Stem-loop formation occurs in single-stranded RNA when two regions of the same strand…
Q: The template strand of a double helical segment of DNA consists of the following sequence:…
A: DNA is first transcribed into messenger RNA and then mRNA is translated into protein sequence.
Q: For double-stranded DNA, which of the following statements is true? a) A = C b) A = G and C = T c) A…
A: For double stranded DNA, According to Chargaff's rules state that DNA from any species of any…
Q: Which of the following describes a Z-DNA helix? a. It is inhibited by methylation of bases b. It is…
A: DNA is a polymer made up of two polynucleotide chains that coil around each other to form a double…
Q: You are characterizing a DNA-binding protein, and have used genetic experiments to identify a domain…
A: Proteins have a secondary structure which is 3D one and the two most common of these are the alpha…
Q: To create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3',…
A: DNA: RNA hybrid are the structures that are formed between the newly synthesized RNA and the dsDNA.…
Q: hat will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’?…
A: introduction
Q: Aflatoxin B1 is a highly mutagenic and carcinogenic compound produced by certain fungi that infect…
A: Aspergillus flavus and Aspergillus parasiticus are commonly known molds in soil, hay, grains, and…
Q: which of the following sequences would most likely be able to bind a cyclic amp dna binding protein?…
A: Introduction: Nucleotides are the nitrogenous base, a pentose sugar and phosphate group. Nucleotides…
Q: A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a…
A: Melting temperature is the point at which 50% of double-helical DNA is changed into a…
Q: Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents…
A: Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) Sense strand is also known as…
Q: The following sequences of DNA would be synthesized using 5′-CAGTTCGGA-3′ as a template: *…
A: DNA is synthesized in 5' to 3' direction.
Q: In Watson and Crick's model of DNA structure, the two strands of the DNA double helix are joined…
A: The Watson Crick model of DNA 1953 is a double stranded, helical molecules.
Q: TRUE OR FALSE a) The 2 chains composing one double helix run in opposite directions; they are…
A: All living organisms are made up of cells, which are the most basic unit of life. They are…
Q: If the recognition sequence of the restriction enzyme Hindlll is AAGCTT, then how many covalent…
A: The enzymes that are able to cut the DNA at specific sites are known as restriction enzymes. The…
Q: If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the…
A: Here in question, I believe “a” side in Phosphodiester bond refer to the side bond to 3’-C atom of…
Q: Type the matching bases in each DNA sequence. G A T A G C T A G G
A:
Q: . In a supercoiled DNA, a stretch of about 20 base pairs changes from the B form to the Z form. What…
A: DNA is majorly classified into three types as B, A and Z. In B-DNA, there are 10 bases in one…
Q: Which of the following sequences would most likely be able to bind a Cyclic AMP DNA binding protein?…
A: Cyclic AMP or cAMP is one of the most important secondary messenger prevalent in biochemical signal…
Q: Consider the following sequence of DNA: 3'-AGA CCC-5'. a. What dipeptide is formed from this DNA…
A: Mutations can be the change in the sequence of DNA and RNA, and mutations can be caused by a…
Q: Which of the following DNA strands (oligonucleotides) would have a higher melting temperature?…
A: DNA is a double helical molecule which is found in the cells of living organisms. The two strands…
Q: In the Watson-Crick model for the DNA double helix (B form) the A-T and G-C base pairs share all but…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where…
A: DNA is composed of nucleotides which form its building blocks. Each nucleotide comprises a…
Q: A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following…
A: When referring to DNA transcription, the coding strand is the DNA strand whose base sequence…
Which of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA binding protein? (Note that only one strand of the DNA is shown - you will find it helpful to write down the sequence and the sequence of the opposite strand to answer this question.)
a) 5’- G A G C G A T C G C T C - 3’
b) 5’- G A G C G A G A G C G A - 3’
c) 5’- G A G C G A A G C G A G - 3’
Step by step
Solved in 2 steps
- Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?The two strands of a DNA double helix can be separated by heating. if you raised the temperature of a solution containing the following three DNA molecules, in what order do you suppose they would “melt”? explain your answer.A. 5’-GCGGGCCAGCCCGAGTGGGTAGCCCAGG-3’ 3’-CGCCCGGTCGGGCTCACCCATCGGGTCC-5’ B. 5’-ATTATAAAATATTTAGATACTATATTTACAA-3’ 3’-TAATATTTTATAAATCTATGATATAAATGTT-5’C. 5’-AGAGCTAGATCGAT-3’ 3’-TCTCGATCTAGCTA-5’The two strands of a DNA double helix can be separated by heating. If you raise the temperature of a solution containing the three DNA molecules below, in what order do you think these DNAs will "melt"? Explain 1)5’-GCGGGCCAGCCCGAGTGGGTAGCCCAGG-3’ 3’-CGCCCGGTCGGGCTCACCCATCGGGTCC-5’ 2) 5’-ATTATAAAATATTTAGATACTATATTTACAA-3’ 3’-TAATATTTTATAAATCTATGATATAAATGTT-5’ 3) 5’-AGAGCTAGATCGAT-3’ 3’-TCTCGATCTAGCTA-5’
- What will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’? Explain briefly. (1.5) If the base G (denoted by an asterisk) in the sequence 5’-TGATCG*CACAAT-3’ is replaced by C due to a mutation, the new sequence will be 5’-TGATCCCACAAT-3’ what will be the new amino acid sequence? Explain briefly. (1.5) If the anticodon sequence of a tRNA is 5’-GCG-3’, what amino acid will it carry? Explain briefly. (1.5) What would be the effect of mutation if the C is changed to A in the anticodon? Explain briefly. (1.5)Deamination of adenine results in the formation of hypoxanthine. Hypoxanthine selectively base pairs with cytosine. If this error is not corrected, what base pair can the original A·T base pair be converted to after cycles of DNA replication?a) G·C b) C·G c) T·A d) A·GWhy is it unfavorable for RNA molecules to adopt a double-helix structure similar to B-DNA? Because it is entropically unfavorable Because that would cause a steric clash between the sugars and nucleobases Because that would cause a steric clash between the 2' OHs of the sugars and the phosphates Because uracil can't form hydrogen bonds with any other nucleobases
- Indicate whether each of the following base-pairing situations (1) involves two DNA strands, (2) involves a DNA strand and an RNA strand, or (3) could involve either two DNA strands or a DNA strand and an RNA strand? a. A G T U C A b. A C T T G A c. A G U T C A d. C G C G C G a. A G T U C A b. A C T T G A c. A G U T C A d. C G C G C GThe double helical structure of DNA is intrinsically unstable and easily dissociates to form two separate strands. Why? How does this affect the two key biological functions of chromosomal DNA? What would happen if the DNA helices were too stable?What is the base sequence, specified in the 5′-to-3′ direction, for a segment of newly formed DNA if it was formed using the following template DNA segments? 3′ AATGC 5′ 5′ AATGC 3′ 3′ GCAGC 5′ 5′ GCAGC 3′
- The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Indicate the 3’ and 5’ ends of both strands. G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g a G G T T A A C G A T A T T A C C G T t t t a a c C C A G T C C G T t t a g c t G T A T C G A C T G C C c c t a c t C C A A T T 2.Write the pre-mRNA molecule. Indicate the 3’ and 5’ ends. 3. Write the mRNA molecule. Indicate the 3’ and 5’ ends 4. Write the tRNA anticodons corresponding to the codons in the mRNA. 5. Write the sequence of amino acids in the resulting polypeptide.Let’s say that you want to find out the difference in nucleotide sequence among two DNA strands, one of which is isolated from the liver of a liver cancer patient and the other one is isolated from the liver of a healthy individual. How you can do that, please explain in detailsA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: G G C T A G C T G C T T C C T T G G G G A C C G A T C G A C G A A G G A A C C C C T Template strand with its polarity: 3’ C C G A T C G A C G A A G G A A C C C C T 5’ - Coding strand with its polarity: 3’ G G C T A G C T G C T T C C T T G G G G A 5’ Please write out the mRNA sequence generated by the template strand to produce that polypeptide chain.